Advanced BioPerl

From BioPerl

Jump to: navigation, search

Contents

Extending the toolkit

Sometimes a function doesn't quite work they way you want for your special question or environment. You don't want to re-write the module (although discussion of that in the next section) and just want to override the function in the context of your script. This is actually quite easy to do in Perl. For example, say you wanted to parse multiple sequence alignment files where the alignments contain letters (DNA or protein residues), gaps (dashes), and additionally numbers for representing another feature in the sequence like intron phases.

Here is the function as defined in Bio::PrimarySeq.

sub validate_seq {
       my ($self,$seqstr) = @_;
       if( ! defined $seqstr ){ $seqstr = $self->seq(); }
       return 0 unless( defined $seqstr); 
       if((CORE::length($seqstr) > 0) && 
          ($seqstr !~ /^([$MATCHPATTERN]+)$/)) {
           $self->warn("seq doesn't validate, mismatch is " .
                       ($seqstr =~ /([^$MATCHPATTERN]+)/g));
               return 0;
       }
       return 1;
}

And $MATCHPATTERN is defined as

$MATCHPATTERN = 'A-Za-z\-\.\*\?';

However we would like to additionally support numbers \d, and we really only want to support this in the context of alignments. Sequences in alignments are not Bio::PrimarySeq objects but Bio::LocatableSeq objects which is an extension of Bio::PrimarySeq.

sub Bio::LocatableSeq::validate_seq {
    my ($self,$seqstr) = @_;
    if( ! defined $seqstr ){ $seqstr = $self->seq(); }
    return 0 unless( defined $seqstr); 
    if((CORE::length($seqstr) > 0) && ($seqstr !~ /^([A-Za-z\-\.\*\?\d]+)$/)) {
        $self->warn("seq doesn't validate, mismatch is " .
                    ($seqstr =~ /([^A-Za-z\-\.\*\?\d]+)/g));
        return 0;
    }
    return 1;
}

Building new modules

Often the toolkit has a set of functionality that supports what the authors needed, if you need additional functionality it may rely on you to write it! However we designed BioPerl to be flexible and extensible. The parser system (all the modules namespaces that end in IO like Bio::SeqIO or Bio::TreeIO or Bio::SearchIO was especially designed so that new formats could be plugged-in to the system with minimal effort. Let's walk through and an example of writing a parser for a new sequence format.

These fall under the Bio::SeqIO namespace since they are for sequence reading and writing. The convention is to be able to iterate through all the sequences in a file or data stream with the next_seq() method. If one wanted to write sequences the method write_seq accepts sequence objects and writes them out to the filehandle.

Let's pretend the new format is called Jenny's Secret Format, or jsf for short. Choosing a module name can be important but this three letter acronym should suffice. Like all format modules, the jsf module file should be located in a directory called SeqIO which itself is in a directory called Bio - so the file would be called Bio/SeqIO/jsf.pm. Let's pretend the format is very simple (although secret). Here is an example of the format we'll write a parser for:

JSF: ID=N0001 DESC="Sampled from compost" SEQ=CCCCCGGGGGGTTTTTAAAAA 
JSF: ID=N0002 DESC="Sampled from humanure" SEQ=CCCGCCCCGGCAATTTAGTTT 

The module to parse this format would look like this:

package Bio::SeqIO::jsf
 
 use strict;
 use Bio::SeqIO;
 use base 'Bio::SeqIO';         # This ISA Bio::SeqIO object
 use Bio::Seq;
 
 =head2 next_seq
 
 Title   : next_seq
 Usage   : $seq = $stream->next_seq()
 Function: reads and returns the next sequence in the stream
 Returns : Bio::Seq object
 Args    : NONE
 
 =cut
 
 sub next_seq {
   my $self = shift;
   my ($seqstring, $id, $description);
   # read sequences from the filehandle (Bio::SeqIO sets this up for you)
   while( $self->_readline ) { 
     if( m/^JSF: ID=(\S+)\s+DESC="(.+)" SEQ=(\S+)/ ) {
       ($id,$description,$seqstring) = ($1,$2,$3);
       last;
     }
   }
   return unless defined $id && defined $description; # returns undef 
   return Bio::Seq->new(-seq         => $seqstring, 
                        -display_id  => $id,
                        -description => $description);
 }

And the additional method to write the sequence:

=head2 write_seq
   
 Title   : write_seq
 Usage   : $stream->write_seq(@seq)
 Function: writes each $seq object in @seq to the stream
 Returns : 1 for success and 0 for error
 Args    : array of 1 to n Bio::PrimarySeqI objects
  
 =cut
  
 sub write_seq {
  my ($self,@seq) = @_;
  for my $seq ( @seq ) {
   $self->_print(sprintf("JSF: ID=%s DESC=\"%s\" SEQ=%s\n"), 
                 $seq->display_id, $seq->description, $seq->seq);
  }
 }

Reusing Code and Working in Collaborative Projects

The biggest problem often in reusing a code base like BioPerl is that it requires both the people using it and the people contributing to it to change their attitude towards code. Generally, people in bioinformatics are more likely to be self-taught programmers who put together most of their scripts or programs working alone. BioPerl is truly a collaborative project (the core code is the product of about 15 individuals) and anyone will be only contributing some part of it in the future.

Here are some notes about how a coding style can change to work in collaborative projects.

Learn to Read Documentation

Reading documentation is sometimes as tough as writing the documentation. Try to read documentation before you ask a question - not only might it answer your question, but more importantly it will give you idea why the person who wrote the module wrote it - and this will be the frame work in which you can understand his or her answer.

You might also want to examine the models, or class diagrams, in the models directory. These diagrams are not guaranteed to include every single class but may help you understand the overall layout of BioPerl's modules.

Documentation on Bio::Root::Root can also be found in the form of scripts - check the examples/root directory for a start, as well as Bio::Root::Root.

Respect People's Code

If the code does what you want, the fact that it is not written exactly the way you would write is not grounds for removing it or completely rewriting it. Of course, if there is an error in calculations or an identified significant performance bottleneck, then that is worth pointing it out to the author and the developer community. However, dismissing a module on the basis of its coding style is not a productive thing to do.

That said, it is still important that we periodically audit code to take advantage of new ideas in software design and to do performance profiling on code. Perl as a language is still being updated and especially as aspects of Perl6 make their way to the wild we will have opportunities to review BioPerl code in the light of language improvements. The toolkit is a project that is evolving and benefits from a fresh look so we still welcome your constructive criticism, especially if you are willing to help make the changes.

Learn How to Provide Good Feedback

This ranges from giving very accurate bug reports through to pointing out design issues in a constructive manner (not this sucks). If you find a problem, then providing a patch using diff or a work around is a great thing to do - the author/maintainer of the module will love you for it.

Providing "I used XXX and it did just what I wanted it to do" feedback is also really great. Developers generally only hear about their mistakes. To hear about successes gives everyone a warm glow.

One trick we have learnt is that when we download a new project/code or use a new module we open up a fresh buffer in emacs and keep a mini diary of everything that we did or thought when we started to use the package. After we used it we could go back, edit the buffer and then send it to the author either with "it was great - it did just what I wanted, but I found that the documentation here was misleading" to "to get it to install I had to incant the following things..."

Taking on a Project

When you want to get involved, hopefully it will be because you want to extend something or provide better facilities to something. The important thing here is not to work in a vacuum. Providing the main list with a good proposal before you start about what you are going to do (and listen to the responses) is a must. We have been pulled up so many times by other people looking at our designs that we can't imagine coding stuff now without feedback.

Designing Good Tests

Sadly, you might think that you have written good code, but you don't know that until you manage to test it! The CPAN style perl modules have a wonderful test suite system (delve around into the t/ directories) and we have extended the makefile system so that the test script which you write to test the module can be part of the t/ system from the start. Once a test is in the t/ system it will be run millions of times worldwide when BioPerl is downloaded, providing incredible and continual regression testing of your module, for free!

A good tool for assessing how well your tests cover your code is the Devel::Cover module.

Writing POD documentation

One of the things you'll always hear about BioPerl is that it's lacking in documentation, and we have to admit that it's true. If you are writing code for BioPerl make sure to redress this issue by writing good POD. Start by using an existing module as a template (or use bioperl.lisp if you're an Emacs user). Fill in those NAME, SYNOPSIS, DESCRIPTION, and AUTHOR sections.

Most authors have also documented their methods. The typical approach is to give the method Name and describe the Usage, Function, Arguments, what it Returns, and then an Example. Note that private or internal method names are always preceded by "_".

Having Fun

The coding process should be enjoyable, and we get very proud of people who tell us that they picked up BioPerl and it worked for them, even if they don't use a single module that we wrote. There is a brilliant sense of community in BioPerl about providing useful, stable code and it should be a pleasure to contribute to it.

So - we are always looking forward to people posting on the bioperl-l list with their feedback/questions/proposals. As well as the long standing fun we have making new releases.

The Bio::Root::Root Object

All objects in BioPerl should inherit from Bio::Root::Root, except for interfaces. The BioPerl root object allows a number of very useful concepts to be provided. In particular.

Exceptions, warning, and debugging

The BioPerl Root object allows exceptions to be thrown by the object with very nice debugging output. These are thrown by calling the method throw() and passing in the message string. This will cause the execution of the script to die with a stack trace.

Similarly the warn() method can be called which will produce a warning message - use this instead of print for warning messages to the user because if the verbose flag is set to -1 warnings will be skipped. Additionally setting the verbose flag to 1 will print a stack trace for every warning in addition to the message and setting verbose to 2 will convert warnings into thrown exceptions.

Finally, the the debug() method prints messages to STDERR when the verbose flag is set to 1.

_rearrange()

BioPerl root object have some helper methods, in particular _rearrange() to help functions which take hash inputs. This allows one to specify named arguments as a hash and map them to the expected input parameters specified by an array.

You can go to Bio::Root::Root for more information. There are also a number of useful example scripts in the examples/root directory.

Using the Root object

To use the root object, the object has to inherit from it. This means the @ISA array should have Bio::Root::Root in it and that the module has a use Bio::Root::Root (if you are an Emacs user, consider using the boilerplate methods in the bioperl.lisp to lay out your module initially for you). The root object provides a top level new function. You should inherit from this new method by calling the new() method of the superclass which is accessible by using SUPER. This is called chaining the constructors and allows a child class to utilize the initialization procedure of the superclass in addition to executing its own. This is a very powerful technique and allows BioPerl to behave in an object-oriented manner.

The full code is given below for a basic skeleton object that uses BioPerl:

 # convention is that if you are using the Bio::Root::Root object you
 # should put it inside the Bio namespace

 package Bio::MyNewObject;

 use strict;
 use base qw(Bio::Root::Root);
 # add additional use statements as needed

 sub new {
    my($class,@args) = @_;
    # call superclasses initialize
    my $self = $class->SUPER::new(@args);

    # do your own argument processing here

    my ($arg1) = $self->_rearrange([qw(NAMEDARGUMENT1)], @args);

    # set default attributes etc...

    return $self;
 }

Method names

A few general rules, not so rigorously enforced (thanks to Hilmar Lapp for pointing this out). Please keep in mind these are general guidelines; if there are questions please post them to the mailing list. Above all, respect other's code.

  • Historically, accessor or getter/setter method names correspond to parameters that are passed to the constructor.
    • These are normally explicitly defined (i.e. no AUTOLOAD'ed methods, though see below for a bit of BioPerl controversy regarding the use of AUTOLOAD).
$seq->alphabet;
$seq->seq;
  • Methods which return lists of objects should start with a capital letter. This has been (by far) one of the least enforced rules, but it helps when trying to determine whether the data returned is scalar or an object, and (if the latter) what the object class is.
    • If the method is just a getter/setter for a single object, it's safe to leave it lower-case.
$seq->species; # single Bio::Species
$feature->location; # single Bio::LocationI 
  • If the method is read-only (just a getter) you might consider using get_{data/Class} as it's more explicit.
  • Methods which return lists of data should use the syntax get_{Class}s or get_{data}s (using plural); the first returning a list of objects and the second returning a list of strings, scalars, etc.
    • If the data is nested (such as SeqFeatures) then using a get_{data} method should only retrieve the top layer. Methods which retrieve the whole flattened list would use get_all_{Class}. Some have used this convention interchangeably (normally not a problem if the data isn't nested).
$collection->get_all_Annotations; # should be a flattened list of Bio::AnnotationI
$feature->get_all_annotation_keys; # list of scalar data; is it nested? 
  • Avoid naming methods which return multiple values each_{data/Class} if possible as the use of 'each' is ambiguous to most users. Is it an iterator? A list? Does it return a key-value pair like Perl each?
  • Iterator methods should use next_{Class/data} instead, which is much more explicit in meaning:
# ambiguous (dual meaning)
for my $feat ($obj->each_Feature) {...}
my @features = $obj->each_Feature;
 
# more explicit 
while (my $seq = $seqin->next_seq) {...} # though should it be next_Seq()? oh well...
my @features = $obj->get_SeqFeatures;

Notes

The guidelines above are meant for developers who want to contribute new code.

We have started converting some methods over to conform to the above and have started deprecating older methods. We know that there are several (hundred?) more examples of methods that still fall outside of the above guidelines, as well as code that runs afoul of numerous Best Practices (most BioPerl methods, for instance, do not have separate getter and setter methods). There is no need to point out X method in Y class doesn't follow the rules.

Realize that a majority of the core code was developed prior to the introduction of the guidelines above. Lack of code changes partially stems from a reluctance to deviate from the original API, which will frustrate long-term users or interfere with older scripts when in production use (see the mailing list thread on Feature/Annotation changes if you want to see how some changes can have a very significant impact). For most users the code gets the job done, so digging into critical code that works well as-is isn't very high on the list of project priorities.

Throwing Exceptions

Exceptions are die functions, in which the $@ variable, a scalar, is used to indicate how it died. The exceptions can be caught using the eval {} system. The BioPerl root object has a method called throw which calls die but also provides a full stack trace of where this throw happened on. So an exception like

 $obj->throw("I am throwing an exception");

Provides the following output on STDERR if it is not caught.

------------- EXCEPTION: Bio::Root::Exception -------------
MSG: I am throwing an exception
STACK: Error::throw
STACK: Bio::Root::Root::throw /home/jason/bioperl/core/Bio/Root/Root.pm:313
-----------------------------------------------------------

Indicating that this exception was thrown at line 7 of subroutine my_subroutine, in myscript.pl.

Exceptions can be caught using an eval block, such as

my $obj = Bio::SomeObject->new();
my $obj2
eval {
  $obj2 = $obj->method1();
  $obj2->method2(10);
};

if( $@ ) {
  # exception was thrown
  &tell_user("Exception was thrown, preventing whatever I wanted to do. 
             Actual exception $@");
  exit(0);
}

# else - use $obj2

Notice that the eval block can have multiple statements in it, and also that if you want to use variables outside of the eval block, they must be declared with my outside of the eval block (you are planning to use strict in your scripts, aren't you!).

This context is particularly useful when objects are produced from a database. This is because some exceptions are really due to problems with the data in an object rather than the code. These sort of exceptions are better tracked down when you know where the object came from, not where in the code the exception is thrown.

One of the drawbacks to this scheme is that the attribute name is "special" from BioPerl's perspective. We believe it is best to stay away from using $obj->name() to mean anything from the object's perspective (for example id()), leaving it free to be used as a context for debugging purposes. You might prefer to overload the name attribute to be "useful" for the object.

See scripts/root_object/error.pl from Bioperl scripts for demonstration code.

Bioperl Interface design

BioPerl has been moving to a split between interface and implementation definitions. An interface is solely the definition of what methods one can call on an object, without any knowledge of how it is implemented. An implementation is an actual, working implementation of an object. In languages like Java, interface definition is part of the language. In Perl, like many aspects of Perl, you have to roll your own.

In BioPerl, the interface names are called Bio::MyObjectI, with the trailing I indicating it is an interface definition of an object. The interface files (sometimes nicknamed the 'I files') provide mainly documentation on what the interface is, and how to use and implement it. All the functions which the implementation is expected to provide are defined as subroutines, and then die with an informative warning. The exception to this rule are the implementation independent functions.

Objects which want to implement this interface should inherit the Bio::MyObjectI file in their @ISA array. This means that if the implementation does not provide a method which the interface defines, rather than the user getting a "method not found error" it gets a "mymethod() was not defined in MyObjectI, but should have been" which makes it clearer that whoever provided the implementation was to blame, and not the caller/script writer.

When people want to check they have valid objects being passed to their functions they should test the presence of the interface, not the implementation. For example:

 sub my_sequence_routine {
   my($seq,$other_argument) = @_;

   # this is the CORRECT way to check the argument type
   $seq->isa('Bio::SeqI') || die "[$seq] is not a sequence. Cannot process";

   # do stuff
 }

This is in contrast to:

 sub my_incorrect_sequence_routine {
   my($seq,$other_argument) = @_;

   # this line is INCORRECT
   $seq->isa('Bio::Seq') || die "[$seq] is not a sequence. Cannot process";

   # do stuff
 }

Rationale of Interface Design

Some people might justifiably argue "why do this?". The main reason is to support external objects from BioPerl, and allow them to masquerade as real BioPerl objects. For example you might have your own quite intricate sequence object which you want to use in BioPerl functions, but don't want to lose your own neat coding. One option would be to have a function which built a BioPerl sequence object from your object, but then you would be endlessly building temporary objects and destroying them, in particular if the script yo-yoed between your code and BioPerl code.

A better solution would be to implement the Bio::SeqI interface. You would read Bio::SeqI, and then provide the methods which it required, and put Bio::SeqI in your @ISA array. Then you could pass in your object into Bioperl routines and - voila - you are a BioPerl sequence object.

A problem might arise if your object has the same methods as the Bio::SeqI methods but use them differently - your $obj->id() might mean provide the raw memory location of the object, whereas the documentation for Bio::SeqI $obj->id() says it should return the human-readable name. If so you need to look into providing an 'Adaptor' class, as suggested in the Gang-of-four [1].

Interface classes really come into their own when we start leaving Perl and enter extensions wrapped over C or over databases, or through systems like CORBA to other languages, like Java/Python etc. Here the "object" is often a very thin wrapper over a DBI interface, or an XS interface, and how it stores the object is really different. By providing a very clear, implementation free interface with good documentation there is a very clear target to hit.

Some people might complain that we are doing something very "un-perl-like" by providing these separate interface files. They are 90% documentation, and could be provided anywhere, in many ways they could be merged with the actual implementation classes and just made clear that if someone wants to mimic a class they should override the following methods. However, we (and in particular myself - Ewan Birney) prefer a clear separation of the interface. It gives us a much clearer way of defining what is going on. It is in many ways just "design sugar" (as opposed to syntactic sugar) to help us, but it really helps, so that's good enough justification to me.

Implementation functions in Interface files

One of the issues we discovered early on in using Interface files was that there were methods that we would like to provide for classes which were independent of their implementation. A good example is a "Range" interface, which might define the following methods

 $obj->start()
 $obj->end()

Now a client to the object might want to use a $obj->length() method, because it is much easier than retrieving the two attributes and subtracting them. However, the length() method is just a pain for someone providing the implementation to provide - once start() and end() is defined, length is. There seems to be a Catch-22 here: to make an object definition good for a client one needs to have additional, helper methods "on top of" the interface, however to make life easier for the object implementation one wants to have the bare minimum of functions defined which the implementer has to provide.

In the Range interface this became more than annoyance, as a lot of the "smarts" of the Range system was that we wanted to have the ability to say

 if( $range->intersection($someother_range) )

We wanted a generic RangeI interface that we could apply to many objects, with definitions required only for start, end and strand. However we wanted the intersection, and union methods to be on all ranges, without us having to reimplement this every time.

Our solution was to allow implementation into the RangeI interface file, but only when these implementations sat "on top" of the interface definition and therefore provided helper client operations. In a language like Java, we would clearly have two classes, with a composition/delegation method:

  MyPublicSomethingClass has-a MyInternalSomethingInterface

with

  ADifferentImplemtation implements MyInternalSomethingInterface

However this is really heavy handed in Perl (and people were complaining about having different implementation/interface classes). We were quite happy about merging the implementation independent functions with the interface definition, and we have used this in other interfaces since then. The documentation has to be clear about what is going on, but we think in general it is.

A Note on Performance

Since Object Oriented programming in Perl 5 is not as elegant as intentionally object oriented programming languages we incur some overhead when calling the chained new constructors. For most cases this is perfectly okay as the object creation is not a significant portion of many of the procedures. However in certain cases - reading in a large number of sequences with features requires the creation of many objects and can perform poorly. One can work around this by creating the hashes directly and NOT chaining the new calls. An example of this is implemented in the Bio::SeqIO::FTHelper objects in the treatment of Location objects for features. Please see Bio::SeqIO::FTHelper for details.

Notes on Accessor Methods

This is mostly taken from tail end of a bioperl-l thread, message by Chris Mungall.

Questions about accessors come up quite frequently on the list, and offline in various discussions between Bioperl developers. What follows is a summary of these discussions.

The consensus is that bioperl should be consistent, and employ consistent styles throughout modules. It would be disastrous if there was a mixture of both explicit get-setters and a hodge-podge of different AUTOLOAD conventions.

Bioperl developers seem to be religiously divided over using AUTOLOAD for accessors. The majority of those that contribute most to Bioperl prefer explicit accessor methods, they feel that explicit method definitions means easier-to-understand code. However, AUTOLOAD appears to be used fairly frequently in bioperl-run modules.

Then there are those of us for whom the multitude of explicit getsetters (and accompanying POD docs) in Perl is the programming equivalent of fingernails scratching a blackboard, both anti-Perl and anti "every principle we hold dear in programming" such as high-level declarative compact code and data representations, accessor methods that type-check consistently, and eliminating repetition/redundancy. However, such delicate aesthetics are often a barrier to producing vast and enormously useful modules such as Bioperl.

Nevertheless, we feel we have a point, and the difficulties many new users have in grokking the large and complex bioperl OM backs us up, IOHO. However, the way to proceed is neither to harangue busy coders who have better things to do, nor to introduce AUTOLOADed declarative data representation formalisms in a piecemeal or ad-hoc way.

This has to be a separate pilot project, and we don't think we have a clear idea of what this would be yet. It may use something like Class::MethodMaker, which is extremely nice, but could perhaps be extended even further. Class::Contract is extremely powerful, and borrows features from proper, well-designed OO languages; unfortunately, Class::Contract is more of a showpiece module and isn't very practical. Perhaps some merger of the two? We'll be slightly hampered here until there is a clear technical solution we can consistently use; but it is definitely worthwhile taking our time and proceeding carefully with the best AUTOLOAD solution.

Ideally someone should be able to grok the majority of the bioperl OM by scrolling through a few pages of ascii text using a compact declarative representation.

Many of us are interested in this parallel project, with a view to winning over the AUTOLOAD skeptics and forming the basis of Bioperl-2.x, but this is only going to happen if we get coding. Moaning or patronising on the list about the existing codebase achieves nothing other than annoying people.


References

  1. Erich Gamma, Richard Helm, Ralph Johnson and John Vlissides. Design patterns : elements of reusable object-oriented software. 1994. Addison-Wesley: Reading, Mass. Also see Design Patterns book [GoF]
Personal tools