Adding a DNA track
From BioPerl
The hack
I thought this was helpful, since the only DNA track example documentation I could find was in the POD of bioperl-live (not on search.cpan.org yet). Thoughts? --Jhannah 02:48, 13 May 2008 (UTC)
The script
use strict; use Bio::Graphics; use Bio::SeqFeature::Generic; # ------------------------ # Configure these... ( name start end ) my @stuff = qw( thing1 2 6 thing2 14 10 thing3 12 16 thing4 18 22 ); my $seq = 'ACGGTCGATCGATCGATCGATCGTACGATCG'; # ------------------------ my $panel = Bio::Graphics::Panel->new( -length => length($seq), # bp -width => length($seq) * 7, # pixels ); # Add the arrow at the top. my $full_length = Bio::SeqFeature::Generic->new( -start => 1, -end => length($seq), ); $panel->add_track($full_length, -glyph => 'arrow', -tick => 2, -fgcolor => 'black', -northeast => 1, ); # Data track... my $track = $panel->add_track( -glyph => 'generic', -stranded => 1, -label => 1, ); # Add each feature to the data track. while (@stuff) { my ($name, $start, $end) = splice @stuff, 0, 3; my $feature = Bio::SeqFeature::Generic->new( -strand => $start < $end ? 1 : -1, -display_name => $name, -start => $start, -end => $end, ); $track->add_feature($feature); } # Add the DNA track to the bottom. my $dna = Bio::PrimarySeq->new( -seq => $seq ); my $feature = Bio::SeqFeature::Generic->new( -start => 1, -end => length($seq) ); $feature->attach_seq($dna); $panel->add_track( $feature, -glyph => 'dna' ); # Send to a .png file. print $panel->png;
Output:
to the #top


