AGAVE sequence format

From BioPerl
Jump to: navigation, search


Description

AGAVE - Architecture for Genomic Annotation, Visualization and Exchange - is an XML format developed by "DoubleTwist" (now defunct) for managing, visualizing and sharing annotations of genomic sequences.

See http://www.agavexml.org/

This file format can be parsed by the Bio::SeqIO system using the Bio::SeqIO::agave module.

Example

<bio_sequence seq_length="11727"        
   molecule_type="DNA" 
   organism_name="Homo sapiens" t
   axon_id="9606" 
   clone_id="RP11-17E16" 
   clone_library="RPCI-11 Human Male BAC" chromosome="8 (Fingerprint)">

    <db_id id="AC011652F7" version="AC011652F7.4" db_code="gb"/>
    <description>Homo sapiens clone RP11-17E16, WORKING DRAFT SEQUENCE,   
10 unordered pieces.</description>
    <keyword>HTGS_PGD; HTG; HTGS_PHASE1; HTGS_DRAFT.</keyword>
    <sequence>
caactctggtggtttggggctttggcatctaaactcttaggaaaaaggcacggtctcccttgacctttgtc

...

   </sequence>
   <xrefs>
      <xref>
         <db_id id="9606" db_code="taxon"/>
      </xref>
      <xref>
         <db_id id="AC011652" db_code="gb"/>
      </xref>
   </xrefs>
   <sequence_map label="GenBank Annotations">
      <annotations>
      ...
      </annotations>
   </sequence_map>
   <map_location map_type="radiation_hybrid" source="washu" units="cR" 
chromosome="8">
      <map_position pos="498.92"/>
    </map_location>
    <map_location map_type="fingerprint" source="washu" units="kb" 
chromosome="8">
       <map_position pos="8748">
          <db_id id="ctg17944" db_code="washu_ctg"/>
       </map_position>
    </map_location>
 </bio_sequence>
Personal tools
Namespaces
Variants
Actions
Main Links
documentation
community
development
Toolbox