From cjfields at illinois.edu Fri Jan 2 10:27:55 2009 From: cjfields at illinois.edu (Chris Fields) Date: Fri, 2 Jan 2009 09:27:55 -0600 Subject: [Bioperl-l] BioPerl 1.6 RC1 In-Reply-To: <495555B2.6050103@sendu.me.uk> References: <466ED6E6-29CF-48E2-B6A6-4241F2E6459B@illinois.edu> <495555B2.6050103@sendu.me.uk> Message-ID: On Dec 26, 2008, at 4:07 PM, Sendu Bala wrote: > Alex Lancaster wrote: >> Some other oddness: when the Build.PL script checks for the >> dependencies, it notes a few optional CPAN packages which aren't yet >> packaged for Fedora such as 'Algorithm::Munkres' and 'Math::Random', >> are missing. Since they are optional and missing dependencies, I >> would have expected that the relevant bioperl modules such >> Bio::PhyloNetwork should also not be installed, but it appears that >> the .pm files are installed, see lines like: >> Copying Bio/PhyloNetwork/Factory.pm -> blib/lib/Bio/PhyloNetwork/ >> Factory.pm >> from the full build.log: >> https://koji.fedoraproject.org/koji/getfile?taskID=1022511&name=build.log >> This causes problems because RPM then generates Requires such as: >> Requires: perl(Algorithm::Munkres) >> (see bottom of the build.log referred to above) which can't (yet) be >> fullfilled by any other package in the Fedora package set, leading to >> broken dependencies. >> Is this the expected behaviour upon missing optional dependencies? > > Yes, though I can see how it's broken from your point of view. It is > set up to install everything, but simply not everything will work > without the optionals. I hadn't considered not installing the > modules that won't work. > > Something to think about, but it's probably not going to happen for > 1.6? Not for 1.6.0, maybe for 1.6.x. This would need to be worked out on main trunk and merged over to the branch if it works. chris From cjfields at illinois.edu Fri Jan 2 10:40:47 2009 From: cjfields at illinois.edu (Chris Fields) Date: Fri, 2 Jan 2009 09:40:47 -0600 Subject: [Bioperl-l] BioPerl 1.6 RC1 In-Reply-To: References: <466ED6E6-29CF-48E2-B6A6-4241F2E6459B@illinois.edu> Message-ID: <5BB71704-8326-4087-BB9A-2B890AAC30B9@illinois.edu> Hilmar, Bio::PhyloNetwork is now published, so I would assume the API has stabilized enough (not that publications are any metric): http://www.ncbi.nlm.nih.gov/pubmed/18371228 http://www.ncbi.nlm.nih.gov/pubmed/18477576 I'm planning on releasing RC2 sometime in the next few days. Does anyone think we should leave this out? chris On Dec 26, 2008, at 6:15 PM, Hilmar Lapp wrote: > > On Dec 26, 2008, at 4:39 PM, Alex Lancaster wrote: > >> it notes a few optional CPAN packages which aren't yet >> packaged for Fedora such as 'Algorithm::Munkres' and 'Math::Random', >> are missing. Since they are optional and missing dependencies, I >> would have expected that the relevant bioperl modules such >> Bio::PhyloNetwork should also not be installed > > > I may have failed to chime in here earlier at the appropriate > opportunity, but I would be very hesitant about putting > Bio::PhyloNetwork into the stable release. > > These modules have never been announced or discussed on the mailing > list with other developers AFAIAA, and so have never received any > scrutiny. I'm also not sure who else other than the authors are > using them, so I don't think there's a user base yet that could > substitute for developer scrutiny. One simple suggestion for example > would be to move them into Bio::Phylo::Network, so as not to > unnecessarily proliferate the first level package directory. So at > the very least it should be obvious to anyone that the API including > the module names are subject to change. > > -hilmar > > -- > =========================================================== > : Hilmar Lapp -:- Durham, NC -:- hlapp at gmx dot net : > =========================================================== > > > From cjfields at illinois.edu Fri Jan 2 15:15:37 2009 From: cjfields at illinois.edu (Chris Fields) Date: Fri, 2 Jan 2009 14:15:37 -0600 Subject: [Bioperl-l] BioPerl 1.6 RC1 In-Reply-To: <536f21b00812301048m4d40a5eei3078a9d7603c14b6@mail.gmail.com> References: <466ED6E6-29CF-48E2-B6A6-4241F2E6459B@illinois.edu> <4955576B.9010907@sendu.me.uk> <49578100.1040402@sendu.me.uk> <4959880F.4040205@sendu.me.uk> <20081230101616.BMU14207@expms6.cites.uiuc.edu> <536f21b00812301048m4d40a5eei3078a9d7603c14b6@mail.gmail.com> Message-ID: <7279302F-7F25-45C3-A47F-5832BCE6800A@illinois.edu> I asked Lincoln about this but hadn't received a reply; oddly, I removed scripts/biographics and examples/biographics from trunk but the merge didn't remove them from the branch. They won't be in RC2 (Sun-Mon). chris On Dec 30, 2008, at 12:48 PM, Scott Cain wrote: > Hi, > > For the scripts currently in BioPerl core that use BioGraphics, do we > think that they should no longer be distributed with BioPerl but > should instead be moved to the BioGraphics distribution? I imagine > someone trying to use bp_embl2picture.pl and being surprised that it > doesn't work. > > Thoughts? > > Scott > > > On Tue, Dec 30, 2008 at 11:16 AM, Christopher Fields > wrote: >> All, >> >> I can't respond adequately until I return from vacation; I'm >> responding from a dial-up line in Texas (?!?) so responding to each >> message in kind will take a year or two (I did mention that I would >> be away from Dec 26-31, but it looks like that will be until Jan 1). >> >> >> ---- Original message ---- >>> Date: Tue, 30 Dec 2008 02:31:43 +0000 >>> From: Sendu Bala >>> Subject: Re: [Bioperl-l] BioPerl 1.6 RC1 >>> To: Alex Lancaster >>> Cc: bioperl-l at lists.open-bio.org, Chris Fields >> > >>> >>> Alex Lancaster wrote: >>>>>>>>>>> "SB" == Sendu Bala writes: >>>> Also can you clarify the expected name of the tarball, is it >>>> bioperl, >>>> or BioPerl? The 1.5.2 release used bioperl-1.5.2_102.tar.bz2 >>>> whereas >>>> 1.5.9._1 uses BioPerl-1.5.9._1.tar.bz2 and it would be good if >>>> there >>>> was consistency as it really helps from maintaining the packages >>>> and >>>> generating links etc. >>> >>> Naming consistency is built into the system. >>> ./Build dist >>> generates a file named: >>> bioperl-1.5.9_1.tar.bz2 >>> >>> I guess Chris decided to rename the file before uploading, and its >>> up to >>> him what future files are named, but I second your suggestion this >>> should be consistent. >> >> The package is named after the toolkit (BioPerl vs bioperl). We >> can revert back to simply 'bioperl', but since we keep referring to >> the package as 'BioPerl' on the wiki and elsewhere we should use >> that for the CPAN from this point on. >> >>> Chris: I note that extraneous files like 'test.txt' and others >>> made it >>> into the RC1 .tar.gz you uploaded. What I always did was a clean >>> export >>> of the tag and built from there. BTW, the dist action also warns you >>> about modules with their own version: >>> Bio::DB::GFF::Aggregator::orf in >>> this case. You might want to investigate that. >> >> I noticed that it's packaging up everything in the local directory, >> yes (that was after the upload unfortunately). That'll be fixed >> for RC2; I'll look for a more amenable fix when I get back (a >> packlist of files would work around this, but I'm not sure how well >> that will work with a large distro like BioPerl). >> >>>> SB> There would most likely be a single CPAN bundle specifying >>>> all the >>>> SB> different BioPerl packages but without any version number >>>> SB> specifications. When a user installs the bundle it would >>>> install >>>> SB> the latest version of each package. >>>> >>>> SB> Each individual sub-package, on the other hand, would specify >>>> the >>>> SB> version of any other sub-packages or core that it depends on. >>>> >>>> OK, right. So if any of the sub-packages were incremented >>>> independently, would a new bundle be generated, or would new >>>> bundles >>>> only be updated for major releases? Hmm, I'm not sure if >>>> subpackages >>>> with different version numbers from the main package can be >>>> generated >>>> from a single SRPM, so that might be a bit tricky. But if core is >>>> only a small number of CPAN pakcages, that might not be so bad, >>>> although it would mean having to go through review for each of the >>>> (new) CPAN modules and more maintainance, so it might be a while >>>> before it would be in Fedora. When is this scheduled to happen? >>>> (post-1.6, I hope!) >>> >>> 'core' will only ever be one CPAN package (one tarball). >>> A new bundle would not be generated when a sub-package is >>> incremented. >>> The whole point of sub-packages is that they're independent and >>> can be >>> developed and released without affecting core or the other sub- >>> packages. >>> >>> The only reason for a bundle update would be to add more new >>> sub-packages to it. >>> >>> Again, how does Fedora currently emulate CPAN Bundles? >>> >>> >>> Just so we're not getting our wires crossed, in this context 'core' >>> would be BioPerl-1.5.9._1.tar.bz2 and 6 examples of sub-packages >>> would >>> be the .tar.bz2 distribution files for Bio::Graphics, >>> Bio::ASN1::EntrezGene, BioPerl-run, BioPerl-db, BioPerl-network and >>> BioPerl-ext. >>> >>> The kind of thing that could then happen in the future is that (to >>> take >>> some random imaginary examples) BioPerl-1.7.0.tar.bz2 is released as >>> 'core' which is a bit smaller than BioPerl-1.5.9._1.tar.bz2 because >>> Bio::Structure is missing from it, and there is a new independent >>> sub-package released for Bio::Structure, just like what happened >>> with >>> Bio::Graphics. >>> >>> >>>>> "Requires: perl(Bio::Graphics)" >>>> >>>> RPM has a script with heuristics that search .pm and .pl files for >>>> 'use ' type constructs to automatically generate >>>> 'Requires", that sometimes guess wrong. To check, I grepped an >>>> exploded package for instances of 'Bio::Graphics' and what >>>> returned is >>>> below, at the end of the e-mail. I suspect that the 'use >>>> Bio::Graphics' in some of the installed scripts in bin/ such as >>>> bp_glyphs2-demo.pl are causing the issue. Shouldn't these scripts >>>> perhaps be moved to the Bio::Graphics CPAN module (along with the >>>> scripts in examples/)? >>> >>> Thanks for pointing that out. I'll leave it to Chris to sort that >>> out... >> >> Yes, those scripts should be moved over (already have indicated >> this to Lincoln). I can't check my local svn co (it's sitting >> about ~1000 miles away from me in a closet right now). >> >>>> If the Bio::Graphics is truly not needed, for the moment it is >>>> possible to also override and filter out the bogus Requires until >>>> such >>>> time as these scripts are moved to the appropriate place. >>> >>> Great, go ahead and do that if you like. >> >> I'm not quite sure why we are attempting to RPM package up a >> release candidate unless it's strictly for the purposes of testing >> things out. I anticipate the final 1.6 will be out in short period >> of time (within a few weeks). Maybe this has already been >> answered, just haven't had time to read back along the thread yet. >> >> Anyway, patience everyone. This is an RC not a final release, and >> I anticipated that a few things would probably be screwy. It >> appears only a few things need to be addressed and cleaned up prior >> to a final release, so overall RC1 did what I wanted (including >> uncovering an odd PAML bug according to CPAN Testers). >> >> -c (from the backwoods in Texas) >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > > > > -- > ------------------------------------------------------------------------ > Scott Cain, Ph. D. scott at > scottcain dot net > GMOD Coordinator (http://gmod.org/) 216-392-3087 > Ontario Institute for Cancer Research > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From cjfields at illinois.edu Fri Jan 2 15:34:52 2009 From: cjfields at illinois.edu (Chris Fields) Date: Fri, 2 Jan 2009 14:34:52 -0600 Subject: [Bioperl-l] BioPerl 1.6 RC1 In-Reply-To: <495AD201.4080500@sendu.me.uk> References: <466ED6E6-29CF-48E2-B6A6-4241F2E6459B@illinois.edu> <4955576B.9010907@sendu.me.uk> <49578100.1040402@sendu.me.uk> <4959880F.4040205@sendu.me.uk> <20081230101616.BMU14207@expms6.cites.uiuc.edu> <495AD201.4080500@sendu.me.uk> Message-ID: <3BB553E6-50EA-4D35-8E21-E78BEB2B5721@illinois.edu> On Dec 30, 2008, at 7:59 PM, Sendu Bala wrote: > Christopher Fields wrote: >>> Chris: I note that extraneous files like 'test.txt' and others made >>> it into the RC1 .tar.gz you uploaded. What I always did was a clean >>> export of the tag and built from there. BTW, the dist action also >>> warns you about modules with their own version: >>> Bio::DB::GFF::Aggregator::orf in this case. You might want to >>> investigate that. >> I noticed that it's packaging up everything in the local directory, >> yes (that was after the upload unfortunately). That'll be fixed for >> RC2; I'll look for a more amenable fix when I get back (a packlist of >> files would work around this, but I'm not sure how well that will >> work with a large distro like BioPerl). > > No, no, it wouldn't work at all. The dist action is what /generates/ > the 'packlist' (MANIFEST) - we don't want to have to manually > specify anything because it would be too easy to forget to add new > files and there would be no obvious indication anything was left out > of a distribution. It's very important this remain automatic and > fool proof. > > It should package up everything under version control. Only if there > are things under version control that we don't want packaged should / > exceptions/ manually be added (MANIFEST.SKIP, ne Build.PL). > > Again, all you have to and should do is build from a fresh export of > the tag, not from your normal working directory. You should never do > that in any case, because you might have been working on a module > and have uncommitted changes. My bad, that'll be rectified for the next RC release. chris From alexl at users.sourceforge.net Fri Jan 2 15:53:35 2009 From: alexl at users.sourceforge.net (Alex Lancaster) Date: Fri, 02 Jan 2009 13:53:35 -0700 Subject: [Bioperl-l] BioPerl 1.6 RC1 In-Reply-To: <20081230101616.BMU14207@expms6.cites.uiuc.edu> (Christopher Fields's message of "Tue\, 30 Dec 2008 10\:16\:16 -0600 \(CST\)") References: <466ED6E6-29CF-48E2-B6A6-4241F2E6459B@illinois.edu> <4955576B.9010907@sendu.me.uk> <49578100.1040402@sendu.me.uk> <4959880F.4040205@sendu.me.uk> <20081230101616.BMU14207@expms6.cites.uiuc.edu> Message-ID: >>>>> "CF" == Christopher Fields writes: [...] >>> If the Bio::Graphics is truly not needed, for the moment it is >>> possible to also override and filter out the bogus Requires until >>> such time as these scripts are moved to the appropriate place. >> >> Great, go ahead and do that if you like. CF> I'm not quite sure why we are attempting to RPM package up a CF> release candidate unless it's strictly for the purposes of testing CF> things out. I anticipate the final 1.6 will be out in short CF> period of time (within a few weeks). Maybe this has already been CF> answered, just haven't had time to read back along the thread yet. The Fedora package for BioPerl is strictly being updated on the development branch (aka "rawhide") of Fedora and is not being added to any officially released "stable" versions of Fedora (i.e. F-9 and F-10 are staying at 1.5.2 until 1.6.x final is released and gets some testing in rawhide). In Fedora, it's common practice to package up release candidates on the development branch as it shakes out problems with packaging and can even (as it has in this case) identify issues in the upstream tarballs. In turn, that means that those problems can be fixed upstream before the final release, rather than having to fix things in the package by patching or otherwise modifying the upstream source etc. CF> Anyway, patience everyone. This is an RC not a final release, and CF> I anticipated that a few things would probably be screwy. It CF> appears only a few things need to be addressed and cleaned up CF> prior to a final release, so overall RC1 did what I wanted CF> (including uncovering an odd PAML bug according to CPAN Testers). Right, I understand that this is a RC, not a final release, which is why I'm reporting them now so hopefully things will work smoothly when packaging BioPerl as an RPM in the final release. Alex From bix at sendu.me.uk Fri Jan 2 16:19:54 2009 From: bix at sendu.me.uk (Sendu Bala) Date: Fri, 02 Jan 2009 21:19:54 +0000 Subject: [Bioperl-l] BioPerl 1.6 RC1 In-Reply-To: References: <466ED6E6-29CF-48E2-B6A6-4241F2E6459B@illinois.edu> <4955576B.9010907@sendu.me.uk> <49578100.1040402@sendu.me.uk> <4959880F.4040205@sendu.me.uk> <20081230101616.BMU14207@expms6.cites.uiuc.edu> Message-ID: <495E84FA.2080700@sendu.me.uk> Alex Lancaster wrote: > I understand that this is a RC, not a final release, which is > why I'm reporting them now so hopefully things will work smoothly when > packaging BioPerl as an RPM in the final release. Yeah, thanks Alex, we appreciate it. From hlapp at gmx.net Fri Jan 2 17:42:04 2009 From: hlapp at gmx.net (Hilmar Lapp) Date: Fri, 2 Jan 2009 17:42:04 -0500 Subject: [Bioperl-l] BioPerl 1.6 RC1 In-Reply-To: <5BB71704-8326-4087-BB9A-2B890AAC30B9@illinois.edu> References: <466ED6E6-29CF-48E2-B6A6-4241F2E6459B@illinois.edu> <5BB71704-8326-4087-BB9A-2B890AAC30B9@illinois.edu> Message-ID: On Jan 2, 2009, at 10:40 AM, Chris Fields wrote: > Bio::PhyloNetwork is now published, so I would assume the API has > stabilized enough (not that publications are any metric): Right. I was referring to its integration into BioPerl, not the publication. -hilmar -- =========================================================== : Hilmar Lapp -:- Durham, NC -:- hlapp at gmx dot net : =========================================================== From hlapp at gmx.net Fri Jan 2 17:52:54 2009 From: hlapp at gmx.net (Hilmar Lapp) Date: Fri, 2 Jan 2009 17:52:54 -0500 Subject: [Bioperl-l] BioPerl 1.6 RC1 In-Reply-To: <5BB71704-8326-4087-BB9A-2B890AAC30B9@illinois.edu> References: <466ED6E6-29CF-48E2-B6A6-4241F2E6459B@illinois.edu> <5BB71704-8326-4087-BB9A-2B890AAC30B9@illinois.edu> Message-ID: <9BA1FE8B-37AD-4F50-81BE-56976D85DB9F@gmx.net> On Jan 2, 2009, at 10:40 AM, Chris Fields wrote: > Bio::PhyloNetwork [...] Does anyone think we should leave this out? I would rephrase the question. I think it's a very valuable addition to BioPerl, and the above may be understood as a vote on that, which AFAIAC is not a vote we need to have. Instead, I would ask the following. Generally, i) are there any opinions on whether the Bio::XXX root namespace should be permissively expanded, and ii) should new modules that have not been reviewed yet by core devs be included in a stable release. Specifically with respect to Bio::PhyloNetwork, are there opinions on i) moving or not moving this to the Bio::Phylo::Network namespace, and on ii) harmonizing or not the API as much as possible with the Bio::Tree APIs. (Chris - you would probably agree that the publication neither answers the above questions, nor guarantees for the API's stability.) -hilmar -- =========================================================== : Hilmar Lapp -:- Durham, NC -:- hlapp at gmx dot net : =========================================================== From lincoln.stein at gmail.com Sat Jan 3 10:51:39 2009 From: lincoln.stein at gmail.com (Lincoln Stein) Date: Sat, 3 Jan 2009 10:51:39 -0500 Subject: [Bioperl-l] BioPerl 1.6 RC1 In-Reply-To: <7279302F-7F25-45C3-A47F-5832BCE6800A@illinois.edu> References: <466ED6E6-29CF-48E2-B6A6-4241F2E6459B@illinois.edu> <4955576B.9010907@sendu.me.uk> <49578100.1040402@sendu.me.uk> <4959880F.4040205@sendu.me.uk> <20081230101616.BMU14207@expms6.cites.uiuc.edu> <536f21b00812301048m4d40a5eei3078a9d7603c14b6@mail.gmail.com> <7279302F-7F25-45C3-A47F-5832BCE6800A@illinois.edu> Message-ID: <6dce9a0b0901030751g6f13c373t2c02689008b8857e@mail.gmail.com> Sorry, what's the question? Anything having to do with biographics should be removed as it now has its own separately installable CPAN module. Lincoln On Fri, Jan 2, 2009 at 3:15 PM, Chris Fields wrote: > I asked Lincoln about this but hadn't received a reply; oddly, I removed > scripts/biographics and examples/biographics from trunk but the merge didn't > remove them from the branch. They won't be in RC2 (Sun-Mon). > > chris > > > On Dec 30, 2008, at 12:48 PM, Scott Cain wrote: > > Hi, >> >> For the scripts currently in BioPerl core that use BioGraphics, do we >> think that they should no longer be distributed with BioPerl but >> should instead be moved to the BioGraphics distribution? I imagine >> someone trying to use bp_embl2picture.pl and being surprised that it >> doesn't work. >> >> Thoughts? >> >> Scott >> >> >> On Tue, Dec 30, 2008 at 11:16 AM, Christopher Fields >> wrote: >> >>> All, >>> >>> I can't respond adequately until I return from vacation; I'm responding >>> from a dial-up line in Texas (?!?) so responding to each message in kind >>> will take a year or two (I did mention that I would be away from Dec 26-31, >>> but it looks like that will be until Jan 1). >>> >>> >>> ---- Original message ---- >>> >>>> Date: Tue, 30 Dec 2008 02:31:43 +0000 >>>> From: Sendu Bala >>>> Subject: Re: [Bioperl-l] BioPerl 1.6 RC1 >>>> To: Alex Lancaster >>>> Cc: bioperl-l at lists.open-bio.org, Chris Fields >>>> >>>> Alex Lancaster wrote: >>>> >>>>> "SB" == Sendu Bala writes: >>>>>>>>>>>> >>>>>>>>>>> Also can you clarify the expected name of the tarball, is it >>>>> bioperl, >>>>> or BioPerl? The 1.5.2 release used bioperl-1.5.2_102.tar.bz2 whereas >>>>> 1.5.9._1 uses BioPerl-1.5.9._1.tar.bz2 and it would be good if there >>>>> was consistency as it really helps from maintaining the packages and >>>>> generating links etc. >>>>> >>>> >>>> Naming consistency is built into the system. >>>> ./Build dist >>>> generates a file named: >>>> bioperl-1.5.9_1.tar.bz2 >>>> >>>> I guess Chris decided to rename the file before uploading, and its up to >>>> him what future files are named, but I second your suggestion this >>>> should be consistent. >>>> >>> >>> The package is named after the toolkit (BioPerl vs bioperl). We can >>> revert back to simply 'bioperl', but since we keep referring to the package >>> as 'BioPerl' on the wiki and elsewhere we should use that for the CPAN from >>> this point on. >>> >>> Chris: I note that extraneous files like 'test.txt' and others made it >>>> into the RC1 .tar.gz you uploaded. What I always did was a clean export >>>> of the tag and built from there. BTW, the dist action also warns you >>>> about modules with their own version: Bio::DB::GFF::Aggregator::orf in >>>> this case. You might want to investigate that. >>>> >>> >>> I noticed that it's packaging up everything in the local directory, yes >>> (that was after the upload unfortunately). That'll be fixed for RC2; I'll >>> look for a more amenable fix when I get back (a packlist of files would work >>> around this, but I'm not sure how well that will work with a large distro >>> like BioPerl). >>> >>> SB> There would most likely be a single CPAN bundle specifying all the >>>>> SB> different BioPerl packages but without any version number >>>>> SB> specifications. When a user installs the bundle it would install >>>>> SB> the latest version of each package. >>>>> >>>>> SB> Each individual sub-package, on the other hand, would specify the >>>>> SB> version of any other sub-packages or core that it depends on. >>>>> >>>>> OK, right. So if any of the sub-packages were incremented >>>>> independently, would a new bundle be generated, or would new bundles >>>>> only be updated for major releases? Hmm, I'm not sure if subpackages >>>>> with different version numbers from the main package can be generated >>>>> from a single SRPM, so that might be a bit tricky. But if core is >>>>> only a small number of CPAN pakcages, that might not be so bad, >>>>> although it would mean having to go through review for each of the >>>>> (new) CPAN modules and more maintainance, so it might be a while >>>>> before it would be in Fedora. When is this scheduled to happen? >>>>> (post-1.6, I hope!) >>>>> >>>> >>>> 'core' will only ever be one CPAN package (one tarball). >>>> A new bundle would not be generated when a sub-package is incremented. >>>> The whole point of sub-packages is that they're independent and can be >>>> developed and released without affecting core or the other sub-packages. >>>> >>>> The only reason for a bundle update would be to add more new >>>> sub-packages to it. >>>> >>>> Again, how does Fedora currently emulate CPAN Bundles? >>>> >>>> >>>> Just so we're not getting our wires crossed, in this context 'core' >>>> would be BioPerl-1.5.9._1.tar.bz2 and 6 examples of sub-packages would >>>> be the .tar.bz2 distribution files for Bio::Graphics, >>>> Bio::ASN1::EntrezGene, BioPerl-run, BioPerl-db, BioPerl-network and >>>> BioPerl-ext. >>>> >>>> The kind of thing that could then happen in the future is that (to take >>>> some random imaginary examples) BioPerl-1.7.0.tar.bz2 is released as >>>> 'core' which is a bit smaller than BioPerl-1.5.9._1.tar.bz2 because >>>> Bio::Structure is missing from it, and there is a new independent >>>> sub-package released for Bio::Structure, just like what happened with >>>> Bio::Graphics. >>>> >>>> >>>> "Requires: perl(Bio::Graphics)" >>>>>> >>>>> >>>>> RPM has a script with heuristics that search .pm and .pl files for >>>>> 'use ' type constructs to automatically generate >>>>> 'Requires", that sometimes guess wrong. To check, I grepped an >>>>> exploded package for instances of 'Bio::Graphics' and what returned is >>>>> below, at the end of the e-mail. I suspect that the 'use >>>>> Bio::Graphics' in some of the installed scripts in bin/ such as >>>>> bp_glyphs2-demo.pl are causing the issue. Shouldn't these scripts >>>>> perhaps be moved to the Bio::Graphics CPAN module (along with the >>>>> scripts in examples/)? >>>>> >>>> >>>> Thanks for pointing that out. I'll leave it to Chris to sort that out... >>>> >>> >>> Yes, those scripts should be moved over (already have indicated this to >>> Lincoln). I can't check my local svn co (it's sitting about ~1000 miles >>> away from me in a closet right now). >>> >>> If the Bio::Graphics is truly not needed, for the moment it is >>>>> possible to also override and filter out the bogus Requires until such >>>>> time as these scripts are moved to the appropriate place. >>>>> >>>> >>>> Great, go ahead and do that if you like. >>>> >>> >>> I'm not quite sure why we are attempting to RPM package up a release >>> candidate unless it's strictly for the purposes of testing things out. I >>> anticipate the final 1.6 will be out in short period of time (within a few >>> weeks). Maybe this has already been answered, just haven't had time to read >>> back along the thread yet. >>> >>> Anyway, patience everyone. This is an RC not a final release, and I >>> anticipated that a few things would probably be screwy. It appears only a >>> few things need to be addressed and cleaned up prior to a final release, so >>> overall RC1 did what I wanted (including uncovering an odd PAML bug >>> according to CPAN Testers). >>> >>> -c (from the backwoods in Texas) >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>> >>> >> >> >> -- >> ------------------------------------------------------------------------ >> Scott Cain, Ph. D. scott at scottcain >> dot net >> GMOD Coordinator (http://gmod.org/) 216-392-3087 >> Ontario Institute for Cancer Research >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > -- Lincoln D. Stein Ontario Institute for Cancer Research 101 College St., Suite 800 Toronto, ON, Canada M5G0A3 416 673-8514 Assistant: Renata Musa From cjfields at illinois.edu Sat Jan 3 12:39:11 2009 From: cjfields at illinois.edu (Chris Fields) Date: Sat, 3 Jan 2009 11:39:11 -0600 Subject: [Bioperl-l] BioPerl 1.6 RC1 In-Reply-To: <6dce9a0b0901030751g6f13c373t2c02689008b8857e@mail.gmail.com> References: <466ED6E6-29CF-48E2-B6A6-4241F2E6459B@illinois.edu> <4955576B.9010907@sendu.me.uk> <49578100.1040402@sendu.me.uk> <4959880F.4040205@sendu.me.uk> <20081230101616.BMU14207@expms6.cites.uiuc.edu> <536f21b00812301048m4d40a5eei3078a9d7603c14b6@mail.gmail.com> <7279302F-7F25-45C3-A47F-5832BCE6800A@illinois.edu> <6dce9a0b0901030751g6f13c373t2c02689008b8857e@mail.gmail.com> Message-ID: <80FDCAB9-B163-422D-B75C-0B7FB2604071@illinois.edu> Lincoln, There were several scripts and examples in bioperl-live which have been removed but somehow persisted in the branch and were in 1.6 RC1 (a test also remained which was also removed, t/Graphics/ Pictogram.t). I didn't know if you wanted these moved to Sourceforge; I saw there were several examples already in the Bio::Graphics repository. There were a few other modules in Bio::Graphics namespace moved over to Sourceforge that I wasn't sure whether you wanted to maintain, such as DrawTransmembrane.pm and Pictogram.pm. If needed we can resurrect them in trunk, under either Bio::Graphics or a different namespace (latter is probably better, any suggestions?). They don't appear to rely on other Bio::Graphics modules directly. chris On Jan 3, 2009, at 9:51 AM, Lincoln Stein wrote: > Sorry, what's the question? Anything having to do with biographics > should be > removed as it now has its own separately installable CPAN module. > > Lincoln > > On Fri, Jan 2, 2009 at 3:15 PM, Chris Fields > wrote: > >> I asked Lincoln about this but hadn't received a reply; oddly, I >> removed >> scripts/biographics and examples/biographics from trunk but the >> merge didn't >> remove them from the branch. They won't be in RC2 (Sun-Mon). >> >> chris >> >> >> On Dec 30, 2008, at 12:48 PM, Scott Cain wrote: >> >> Hi, >>> >>> For the scripts currently in BioPerl core that use BioGraphics, do >>> we >>> think that they should no longer be distributed with BioPerl but >>> should instead be moved to the BioGraphics distribution? I imagine >>> someone trying to use bp_embl2picture.pl and being surprised that it >>> doesn't work. >>> >>> Thoughts? >>> >>> Scott >>> >>> >>> On Tue, Dec 30, 2008 at 11:16 AM, Christopher Fields >>> wrote: >>> >>>> All, >>>> >>>> I can't respond adequately until I return from vacation; I'm >>>> responding >>>> from a dial-up line in Texas (?!?) so responding to each message >>>> in kind >>>> will take a year or two (I did mention that I would be away from >>>> Dec 26-31, >>>> but it looks like that will be until Jan 1). >>>> >>>> >>>> ---- Original message ---- >>>> >>>>> Date: Tue, 30 Dec 2008 02:31:43 +0000 >>>>> From: Sendu Bala >>>>> Subject: Re: [Bioperl-l] BioPerl 1.6 RC1 >>>>> To: Alex Lancaster >>>>> Cc: bioperl-l at lists.open-bio.org, Chris Fields >>>> > >>>>> >>>>> Alex Lancaster wrote: >>>>> >>>>>> "SB" == Sendu Bala writes: >>>>>>>>>>>>> >>>>>>>>>>>> Also can you clarify the expected name of the tarball, is >>>>>>>>>>>> it >>>>>> bioperl, >>>>>> or BioPerl? The 1.5.2 release used bioperl-1.5.2_102.tar.bz2 >>>>>> whereas >>>>>> 1.5.9._1 uses BioPerl-1.5.9._1.tar.bz2 and it would be good if >>>>>> there >>>>>> was consistency as it really helps from maintaining the >>>>>> packages and >>>>>> generating links etc. >>>>>> >>>>> >>>>> Naming consistency is built into the system. >>>>> ./Build dist >>>>> generates a file named: >>>>> bioperl-1.5.9_1.tar.bz2 >>>>> >>>>> I guess Chris decided to rename the file before uploading, and >>>>> its up to >>>>> him what future files are named, but I second your suggestion this >>>>> should be consistent. >>>>> >>>> >>>> The package is named after the toolkit (BioPerl vs bioperl). We >>>> can >>>> revert back to simply 'bioperl', but since we keep referring to >>>> the package >>>> as 'BioPerl' on the wiki and elsewhere we should use that for the >>>> CPAN from >>>> this point on. >>>> >>>> Chris: I note that extraneous files like 'test.txt' and others >>>> made it >>>>> into the RC1 .tar.gz you uploaded. What I always did was a clean >>>>> export >>>>> of the tag and built from there. BTW, the dist action also warns >>>>> you >>>>> about modules with their own version: >>>>> Bio::DB::GFF::Aggregator::orf in >>>>> this case. You might want to investigate that. >>>>> >>>> >>>> I noticed that it's packaging up everything in the local >>>> directory, yes >>>> (that was after the upload unfortunately). That'll be fixed for >>>> RC2; I'll >>>> look for a more amenable fix when I get back (a packlist of files >>>> would work >>>> around this, but I'm not sure how well that will work with a >>>> large distro >>>> like BioPerl). >>>> >>>> SB> There would most likely be a single CPAN bundle specifying >>>> all the >>>>>> SB> different BioPerl packages but without any version number >>>>>> SB> specifications. When a user installs the bundle it would >>>>>> install >>>>>> SB> the latest version of each package. >>>>>> >>>>>> SB> Each individual sub-package, on the other hand, would >>>>>> specify the >>>>>> SB> version of any other sub-packages or core that it depends on. >>>>>> >>>>>> OK, right. So if any of the sub-packages were incremented >>>>>> independently, would a new bundle be generated, or would new >>>>>> bundles >>>>>> only be updated for major releases? Hmm, I'm not sure if >>>>>> subpackages >>>>>> with different version numbers from the main package can be >>>>>> generated >>>>>> from a single SRPM, so that might be a bit tricky. But if core >>>>>> is >>>>>> only a small number of CPAN pakcages, that might not be so bad, >>>>>> although it would mean having to go through review for each of >>>>>> the >>>>>> (new) CPAN modules and more maintainance, so it might be a while >>>>>> before it would be in Fedora. When is this scheduled to happen? >>>>>> (post-1.6, I hope!) >>>>>> >>>>> >>>>> 'core' will only ever be one CPAN package (one tarball). >>>>> A new bundle would not be generated when a sub-package is >>>>> incremented. >>>>> The whole point of sub-packages is that they're independent and >>>>> can be >>>>> developed and released without affecting core or the other sub- >>>>> packages. >>>>> >>>>> The only reason for a bundle update would be to add more new >>>>> sub-packages to it. >>>>> >>>>> Again, how does Fedora currently emulate CPAN Bundles? >>>>> >>>>> >>>>> Just so we're not getting our wires crossed, in this context >>>>> 'core' >>>>> would be BioPerl-1.5.9._1.tar.bz2 and 6 examples of sub-packages >>>>> would >>>>> be the .tar.bz2 distribution files for Bio::Graphics, >>>>> Bio::ASN1::EntrezGene, BioPerl-run, BioPerl-db, BioPerl-network >>>>> and >>>>> BioPerl-ext. >>>>> >>>>> The kind of thing that could then happen in the future is that >>>>> (to take >>>>> some random imaginary examples) BioPerl-1.7.0.tar.bz2 is >>>>> released as >>>>> 'core' which is a bit smaller than BioPerl-1.5.9._1.tar.bz2 >>>>> because >>>>> Bio::Structure is missing from it, and there is a new independent >>>>> sub-package released for Bio::Structure, just like what happened >>>>> with >>>>> Bio::Graphics. >>>>> >>>>> >>>>> "Requires: perl(Bio::Graphics)" >>>>>>> >>>>>> >>>>>> RPM has a script with heuristics that search .pm and .pl files >>>>>> for >>>>>> 'use ' type constructs to automatically generate >>>>>> 'Requires", that sometimes guess wrong. To check, I grepped an >>>>>> exploded package for instances of 'Bio::Graphics' and what >>>>>> returned is >>>>>> below, at the end of the e-mail. I suspect that the 'use >>>>>> Bio::Graphics' in some of the installed scripts in bin/ such as >>>>>> bp_glyphs2-demo.pl are causing the issue. Shouldn't these >>>>>> scripts >>>>>> perhaps be moved to the Bio::Graphics CPAN module (along with the >>>>>> scripts in examples/)? >>>>>> >>>>> >>>>> Thanks for pointing that out. I'll leave it to Chris to sort >>>>> that out... >>>>> >>>> >>>> Yes, those scripts should be moved over (already have indicated >>>> this to >>>> Lincoln). I can't check my local svn co (it's sitting about >>>> ~1000 miles >>>> away from me in a closet right now). >>>> >>>> If the Bio::Graphics is truly not needed, for the moment it is >>>>>> possible to also override and filter out the bogus Requires >>>>>> until such >>>>>> time as these scripts are moved to the appropriate place. >>>>>> >>>>> >>>>> Great, go ahead and do that if you like. >>>>> >>>> >>>> I'm not quite sure why we are attempting to RPM package up a >>>> release >>>> candidate unless it's strictly for the purposes of testing things >>>> out. I >>>> anticipate the final 1.6 will be out in short period of time >>>> (within a few >>>> weeks). Maybe this has already been answered, just haven't had >>>> time to read >>>> back along the thread yet. >>>> >>>> Anyway, patience everyone. This is an RC not a final release, >>>> and I >>>> anticipated that a few things would probably be screwy. It >>>> appears only a >>>> few things need to be addressed and cleaned up prior to a final >>>> release, so >>>> overall RC1 did what I wanted (including uncovering an odd PAML bug >>>> according to CPAN Testers). >>>> >>>> -c (from the backwoods in Texas) >>>> _______________________________________________ >>>> Bioperl-l mailing list >>>> Bioperl-l at lists.open-bio.org >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>> >>>> >>> >>> >>> -- >>> ------------------------------------------------------------------------ >>> Scott Cain, Ph. D. scott at >>> scottcain >>> dot net >>> GMOD Coordinator (http://gmod.org/) 216-392-3087 >>> Ontario Institute for Cancer Research >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>> >> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > > > > -- > Lincoln D. Stein > > Ontario Institute for Cancer Research > 101 College St., Suite 800 > Toronto, ON, Canada M5G0A3 > 416 673-8514 > Assistant: Renata Musa > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From cjfields at illinois.edu Sat Jan 3 23:26:41 2009 From: cjfields at illinois.edu (Chris Fields) Date: Sat, 3 Jan 2009 22:26:41 -0600 Subject: [Bioperl-l] BioPerl 1.6 RC1 In-Reply-To: <9BA1FE8B-37AD-4F50-81BE-56976D85DB9F@gmx.net> References: <466ED6E6-29CF-48E2-B6A6-4241F2E6459B@illinois.edu> <5BB71704-8326-4087-BB9A-2B890AAC30B9@illinois.edu> <9BA1FE8B-37AD-4F50-81BE-56976D85DB9F@gmx.net> Message-ID: (cc'ing this to Gabriel and Jason): On Jan 2, 2009, at 4:52 PM, Hilmar Lapp wrote: > On Jan 2, 2009, at 10:40 AM, Chris Fields wrote: > >> Bio::PhyloNetwork [...] Does anyone think we should leave this out? > > I would rephrase the question. I think it's a very valuable addition > to BioPerl, and the above may be understood as a vote on that, which > AFAIAC is not a vote we need to have. > > Instead, I would ask the following. Generally, i) are there any > opinions on whether the Bio::XXX root namespace should be > permissively expanded, and ii) should new modules that have not been > reviewed yet by core devs be included in a stable release. > Specifically with respect to Bio::PhyloNetwork, are there opinions > on i) moving or not moving this to the Bio::Phylo::Network > namespace, and on ii) harmonizing or not the API as much as possible > with the Bio::Tree APIs. On Bio::XXX root namespace expansion: this popped up recently with Bio::Microarray and was discussed on the list. In general I think any expansion of Bio::XXX should be 1) actively discussed on list (i.e. not just assume a non-response means support) and 2) supported by the active core devs. On reviewing core modules for inclusion in a stable release: we simply can't support something that has an unstable API. We are planning on a separate bioperl-dev which can act as a testing ground w/o stifling regular bioperl-* releases. The plan is to also move untested modules there. On Bio::PhyloNetwork specifically: could renaming that to Bio::Phylo::Network lump or confuse these with Rutger's Bio::Phylo modules? I can't specifically speak for Bio::PhyloNetwork's API and how it coordinates with Bio::Tree APIs but Gabriel or Jason could possibly chime in. They seem to use various Bio::* modules but mainly inherit Bio::Root::Root. > (Chris - you would probably agree that the publication neither > answers the above questions, nor guarantees for the API's stability.) Yes, 100% agree, though I feel publishing should put the onus to support the module on the module author, not the core devs (which makes me wonder if it would work better split off from core at some point). I'm not sure what we should do at this point late in the game, but I would support pulling it and leaving it in trunk until a decision is made, then adding it back in a point release at a later point. I need to know something soon, though. I already have RC1 out; RC2 is to be tagged in the next day or two, and I would like to get a final release out in the next few weeks (as well as create 1.6 branches for bioperl- db, bioperl-run, etc). chris > -hilmar > -- > =========================================================== > : Hilmar Lapp -:- Durham, NC -:- hlapp at gmx dot net : > =========================================================== From maj at fortinbras.us Sun Jan 4 09:44:00 2009 From: maj at fortinbras.us (Mark A. Jensen) Date: Sun, 4 Jan 2009 09:44:00 -0500 Subject: [Bioperl-l] intro to BioPerl and R Message-ID: Hilmar, Chris, et al- I need to bite the bullet and integrate R into programs. I realize this a process that is imperfect and in flux at the moment, with several threads devoted to this topic already. Could someone back up one notch and describe (with a link or whatever is easy) how a novice (e.g., me) would begin. I'll make a Scrapbook entry out of the responses- thanks as usual - Mark From valiente at lsi.upc.edu Sun Jan 4 10:51:33 2009 From: valiente at lsi.upc.edu (Gabriel Valiente) Date: Sun, 4 Jan 2009 16:51:33 +0100 Subject: [Bioperl-l] BioPerl 1.6 RC1 In-Reply-To: References: <466ED6E6-29CF-48E2-B6A6-4241F2E6459B@illinois.edu> <5BB71704-8326-4087-BB9A-2B890AAC30B9@illinois.edu> <9BA1FE8B-37AD-4F50-81BE-56976D85DB9F@gmx.net> Message-ID: <0DC7B807-2260-443D-8AE9-798B0EBAA68A@lsi.upc.edu> >>> Bio::PhyloNetwork [...] Does anyone think we should leave this out? >> >> I would rephrase the question. I think it's a very valuable >> addition to BioPerl, and the above may be understood as a vote on >> that, which AFAIAC is not a vote we need to have. >> >> Instead, I would ask the following. Generally, i) are there any >> opinions on whether the Bio::XXX root namespace should be >> permissively expanded, and ii) should new modules that have not >> been reviewed yet by core devs be included in a stable release. >> Specifically with respect to Bio::PhyloNetwork, are there opinions >> on i) moving or not moving this to the Bio::Phylo::Network >> namespace, and on ii) harmonizing or not the API as much as >> possible with the Bio::Tree APIs. > > On Bio::XXX root namespace expansion: this popped up recently with > Bio::Microarray and was discussed on the list. In general I think > any expansion of Bio::XXX should be 1) actively discussed on list > (i.e. not just assume a non-response means support) and 2) > supported by the active core devs. > > On reviewing core modules for inclusion in a stable release: we > simply can't support something that has an unstable API. We are > planning on a separate bioperl-dev which can act as a testing > ground w/o stifling regular bioperl-* releases. The plan is to > also move untested modules there. > > On Bio::PhyloNetwork specifically: could renaming that to > Bio::Phylo::Network lump or confuse these with Rutger's Bio::Phylo > modules? I can't specifically speak for Bio::PhyloNetwork's API > and how it coordinates with Bio::Tree APIs but Gabriel or Jason > could possibly chime in. They seem to use various Bio::* modules > but mainly inherit Bio::Root::Root. > >> (Chris - you would probably agree that the publication neither >> answers the above questions, nor guarantees for the API's stability.) > > Yes, 100% agree, though I feel publishing should put the onus to > support the module on the module author, not the core devs (which > makes me wonder if it would work better split off from core at some > point). > > I'm not sure what we should do at this point late in the game, but > I would support pulling it and leaving it in trunk until a decision > is made, then adding it back in a point release at a later point. > I need to know something soon, though. I already have RC1 out; RC2 > is to be tagged in the next day or two, and I would like to get a > final release out in the next few weeks (as well as create 1.6 > branches for bioperl-db, bioperl-run, etc). As authors of the Bio::PhyloNetwork modules, we have made every effort to conform to the Bio::Tree API. Nevertheless, it would be best if active core developers could please have a closer look. In any case, our motivation in publishing these modules as part of the BioPerl distribution was to make them available to the large community of BioPerl users and if you end up deciding to pull them from the core distribution, they won't be that visible anymore. Regarding renaming Bio::PhyloNetwork to Bio::Phylo::Network, I don't like the idea very much because the Bio::PhyloNetwork modules do not have much in common with Rutger's Bio::Phylo modules. Thanks, Gabriel From cjfields at illinois.edu Sun Jan 4 20:33:18 2009 From: cjfields at illinois.edu (Chris Fields) Date: Sun, 4 Jan 2009 19:33:18 -0600 Subject: [Bioperl-l] BioPerl 1.6 RC1 In-Reply-To: <0DC7B807-2260-443D-8AE9-798B0EBAA68A@lsi.upc.edu> References: <466ED6E6-29CF-48E2-B6A6-4241F2E6459B@illinois.edu> <5BB71704-8326-4087-BB9A-2B890AAC30B9@illinois.edu> <9BA1FE8B-37AD-4F50-81BE-56976D85DB9F@gmx.net> <0DC7B807-2260-443D-8AE9-798B0EBAA68A@lsi.upc.edu> Message-ID: On Jan 4, 2009, at 9:51 AM, Gabriel Valiente wrote: >> ... >> I'm not sure what we should do at this point late in the game, but >> I would support pulling it and leaving it in trunk until a decision >> is made, then adding it back in a point release at a later point. >> I need to know something soon, though. I already have RC1 out; RC2 >> is to be tagged in the next day or two, and I would like to get a >> final release out in the next few weeks (as well as create 1.6 >> branches for bioperl-db, bioperl-run, etc). > > As authors of the Bio::PhyloNetwork modules, we have made every > effort to conform to the Bio::Tree API. Nevertheless, it would be > best if active core developers could please have a closer look. In > any case, our motivation in publishing these modules as part of the > BioPerl distribution was to make them available to the large > community of BioPerl users and if you end up deciding to pull them > from the core distribution, they won't be that visible anymore. > Regarding renaming Bio::PhyloNetwork to Bio::Phylo::Network, I don't > like the idea very much because the Bio::PhyloNetwork modules do not > have much in common with Rutger's Bio::Phylo modules. Thanks, > > Gabriel The question isn't whether they will be included within BioPerl per se, but specifically within the core modules of BioPerl (see below). Judging by your response I think we can include them for the 1.6 release. It might help if we set up bug reports to be passed on to you or others responsible (with the obvious constraint that fixes for 1.6 won't break any API). We can set something up on bugzilla for that; just let me know what email you want reports sent. BioPerl 1.6 is to represent the last 'full' or old-style release. Regarding all modules automatically being in core: we have extensively discussed on the list the problem of code bloat in core. We plan on splitting off specialized modules into subdistributions, similar to bioperl-db, etc, post 1.6. This is something that most (all?) core devs appear to agree on. Based on that I would say that post-1.6, unless the Bio::PhyloNetwork modules prove to be inextricably linked to a large portion of BioPerl classes, I could see these being included in a specialized bioperl- phylo or similar package, kept in a separate subversion repo just like the other bioperl-* distributions. Won't be up to me alone though, and anyone is welcome to discuss this further on the list. chris From valiente at lsi.upc.edu Mon Jan 5 06:20:49 2009 From: valiente at lsi.upc.edu (Gabriel Valiente) Date: Mon, 5 Jan 2009 12:20:49 +0100 Subject: [Bioperl-l] BioPerl 1.6 RC1 In-Reply-To: References: <466ED6E6-29CF-48E2-B6A6-4241F2E6459B@illinois.edu> <5BB71704-8326-4087-BB9A-2B890AAC30B9@illinois.edu> <9BA1FE8B-37AD-4F50-81BE-56976D85DB9F@gmx.net> <0DC7B807-2260-443D-8AE9-798B0EBAA68A@lsi.upc.edu> Message-ID: <2008BB62-AB66-47C7-9969-D85443E03163@lsi.upc.edu> >>> As authors of the Bio::PhyloNetwork modules, we have made every >>> effort to conform to the Bio::Tree API. Nevertheless, it would be >>> best if active core developers could please have a closer look. >>> In any case, our motivation in publishing these modules as part >>> of the BioPerl distribution was to make them available to the >>> large community of BioPerl users and if you end up deciding to >>> pull them from the core distribution, they won't be that visible >>> anymore. Regarding renaming Bio::PhyloNetwork to >>> Bio::Phylo::Network, I don't like the idea very much because the >>> Bio::PhyloNetwork modules do not have much in common with >>> Rutger's Bio::Phylo modules. Thanks, >> >> Gabriel > > The question isn't whether they will be included within BioPerl per > se, but specifically within the core modules of BioPerl (see > below). Judging by your response I think we can include them for > the 1.6 release. It might help if we set up bug reports to be > passed on to you or others responsible (with the obvious constraint > that fixes for 1.6 won't break any API). We can set something up > on bugzilla for that; just let me know what email you want reports > sent. No problem, please put me (valiente at lsi.upc.edu) and also Gabriel Cardona (gabriel.cardona at uib.es). > BioPerl 1.6 is to represent the last 'full' or old-style release. > Regarding all modules automatically being in core: we have > extensively discussed on the list the problem of code bloat in > core. We plan on splitting off specialized modules into > subdistributions, similar to bioperl-db, etc, post 1.6. This is > something that most (all?) core devs appear to agree on. > > Based on that I would say that post-1.6, unless the > Bio::PhyloNetwork modules prove to be inextricably linked to a > large portion of BioPerl classes, I could see these being included > in a specialized bioperl-phylo or similar package, kept in a > separate subversion repo just like the other bioperl-* > distributions. Won't be up to me alone though, and anyone is > welcome to discuss this further on the list. Ok. So far, Bio::PhyloNetwork is linked to Bio::Tree and Bio::TreeIO. Thanks, Gabriel From lincoln.stein at gmail.com Mon Jan 5 10:34:38 2009 From: lincoln.stein at gmail.com (Lincoln Stein) Date: Mon, 5 Jan 2009 10:34:38 -0500 Subject: [Bioperl-l] Bio::Graphics::Pictogram Message-ID: <6dce9a0b0901050734jf93ac87k5293f42ca89841a2@mail.gmail.com> Hi Shawn, You may or may not know that during the preparation for BioPerl 1.6 we split Bio::Graphics off into its own CPAN distribution and are now hosting its CVS at Sourceforge. During the split, I inadvertently grabbed Bio::Graphics::Pictogram and moved it into Sourceforge along with the rest of Bio::Graphics. Do you want to maintain Pictogram out of Sourceforge (I will give you developer access), or move it back into BioPerl for SVN maintenance and release as part of the main Bioperl distribution? Lincoln On Sat, Jan 3, 2009 at 12:39 PM, Chris Fields wrote: > Lincoln, > > There were several scripts and examples in bioperl-live which have been > removed but somehow persisted in the branch and were in 1.6 RC1 (a test also > remained which was also removed, t/Graphics/Pictogram.t). I didn't know if > you wanted these moved to Sourceforge; I saw there were several examples > already in the Bio::Graphics repository. > > There were a few other modules in Bio::Graphics namespace moved over to > Sourceforge that I wasn't sure whether you wanted to maintain, such as > DrawTransmembrane.pm and Pictogram.pm. If needed we can resurrect them in > trunk, under either Bio::Graphics or a different namespace (latter is > probably better, any suggestions?). They don't appear to rely on other > Bio::Graphics modules directly. > > chris > > > On Jan 3, 2009, at 9:51 AM, Lincoln Stein wrote: > > Sorry, what's the question? Anything having to do with biographics should >> be >> removed as it now has its own separately installable CPAN module. >> >> Lincoln >> >> On Fri, Jan 2, 2009 at 3:15 PM, Chris Fields >> wrote: >> >> I asked Lincoln about this but hadn't received a reply; oddly, I removed >>> scripts/biographics and examples/biographics from trunk but the merge >>> didn't >>> remove them from the branch. They won't be in RC2 (Sun-Mon). >>> >>> chris >>> >>> >>> On Dec 30, 2008, at 12:48 PM, Scott Cain wrote: >>> >>> Hi, >>> >>>> >>>> For the scripts currently in BioPerl core that use BioGraphics, do we >>>> think that they should no longer be distributed with BioPerl but >>>> should instead be moved to the BioGraphics distribution? I imagine >>>> someone trying to use bp_embl2picture.pl and being surprised that it >>>> doesn't work. >>>> >>>> Thoughts? >>>> >>>> Scott >>>> >>>> >>>> On Tue, Dec 30, 2008 at 11:16 AM, Christopher Fields >>>> wrote: >>>> >>>> All, >>>>> >>>>> I can't respond adequately until I return from vacation; I'm >>>>> responding >>>>> from a dial-up line in Texas (?!?) so responding to each message in >>>>> kind >>>>> will take a year or two (I did mention that I would be away from Dec >>>>> 26-31, >>>>> but it looks like that will be until Jan 1). >>>>> >>>>> >>>>> ---- Original message ---- >>>>> >>>>> Date: Tue, 30 Dec 2008 02:31:43 +0000 >>>>>> From: Sendu Bala >>>>>> Subject: Re: [Bioperl-l] BioPerl 1.6 RC1 >>>>>> To: Alex Lancaster >>>>>> Cc: bioperl-l at lists.open-bio.org, Chris Fields >>>>> > >>>>>> >>>>>> Alex Lancaster wrote: >>>>>> >>>>>> "SB" == Sendu Bala writes: >>>>>>> >>>>>>>> >>>>>>>>>>>>>> Also can you clarify the expected name of the tarball, is it >>>>>>>>>>>>> >>>>>>>>>>>> bioperl, >>>>>>> or BioPerl? The 1.5.2 release used bioperl-1.5.2_102.tar.bz2 whereas >>>>>>> 1.5.9._1 uses BioPerl-1.5.9._1.tar.bz2 and it would be good if there >>>>>>> was consistency as it really helps from maintaining the packages and >>>>>>> generating links etc. >>>>>>> >>>>>>> >>>>>> Naming consistency is built into the system. >>>>>> ./Build dist >>>>>> generates a file named: >>>>>> bioperl-1.5.9_1.tar.bz2 >>>>>> >>>>>> I guess Chris decided to rename the file before uploading, and its up >>>>>> to >>>>>> him what future files are named, but I second your suggestion this >>>>>> should be consistent. >>>>>> >>>>>> >>>>> The package is named after the toolkit (BioPerl vs bioperl). We can >>>>> revert back to simply 'bioperl', but since we keep referring to the >>>>> package >>>>> as 'BioPerl' on the wiki and elsewhere we should use that for the CPAN >>>>> from >>>>> this point on. >>>>> >>>>> Chris: I note that extraneous files like 'test.txt' and others made it >>>>> >>>>>> into the RC1 .tar.gz you uploaded. What I always did was a clean >>>>>> export >>>>>> of the tag and built from there. BTW, the dist action also warns you >>>>>> about modules with their own version: Bio::DB::GFF::Aggregator::orf in >>>>>> this case. You might want to investigate that. >>>>>> >>>>>> >>>>> I noticed that it's packaging up everything in the local directory, yes >>>>> (that was after the upload unfortunately). That'll be fixed for RC2; >>>>> I'll >>>>> look for a more amenable fix when I get back (a packlist of files would >>>>> work >>>>> around this, but I'm not sure how well that will work with a large >>>>> distro >>>>> like BioPerl). >>>>> >>>>> SB> There would most likely be a single CPAN bundle specifying all the >>>>> >>>>>> SB> different BioPerl packages but without any version number >>>>>>> SB> specifications. When a user installs the bundle it would install >>>>>>> SB> the latest version of each package. >>>>>>> >>>>>>> SB> Each individual sub-package, on the other hand, would specify the >>>>>>> SB> version of any other sub-packages or core that it depends on. >>>>>>> >>>>>>> OK, right. So if any of the sub-packages were incremented >>>>>>> independently, would a new bundle be generated, or would new bundles >>>>>>> only be updated for major releases? Hmm, I'm not sure if subpackages >>>>>>> with different version numbers from the main package can be generated >>>>>>> from a single SRPM, so that might be a bit tricky. But if core is >>>>>>> only a small number of CPAN pakcages, that might not be so bad, >>>>>>> although it would mean having to go through review for each of the >>>>>>> (new) CPAN modules and more maintainance, so it might be a while >>>>>>> before it would be in Fedora. When is this scheduled to happen? >>>>>>> (post-1.6, I hope!) >>>>>>> >>>>>>> >>>>>> 'core' will only ever be one CPAN package (one tarball). >>>>>> A new bundle would not be generated when a sub-package is incremented. >>>>>> The whole point of sub-packages is that they're independent and can be >>>>>> developed and released without affecting core or the other >>>>>> sub-packages. >>>>>> >>>>>> The only reason for a bundle update would be to add more new >>>>>> sub-packages to it. >>>>>> >>>>>> Again, how does Fedora currently emulate CPAN Bundles? >>>>>> >>>>>> >>>>>> Just so we're not getting our wires crossed, in this context 'core' >>>>>> would be BioPerl-1.5.9._1.tar.bz2 and 6 examples of sub-packages would >>>>>> be the .tar.bz2 distribution files for Bio::Graphics, >>>>>> Bio::ASN1::EntrezGene, BioPerl-run, BioPerl-db, BioPerl-network and >>>>>> BioPerl-ext. >>>>>> >>>>>> The kind of thing that could then happen in the future is that (to >>>>>> take >>>>>> some random imaginary examples) BioPerl-1.7.0.tar.bz2 is released as >>>>>> 'core' which is a bit smaller than BioPerl-1.5.9._1.tar.bz2 because >>>>>> Bio::Structure is missing from it, and there is a new independent >>>>>> sub-package released for Bio::Structure, just like what happened with >>>>>> Bio::Graphics. >>>>>> >>>>>> >>>>>> "Requires: perl(Bio::Graphics)" >>>>>> >>>>>>> >>>>>>>> >>>>>>> RPM has a script with heuristics that search .pm and .pl files for >>>>>>> 'use ' type constructs to automatically generate >>>>>>> 'Requires", that sometimes guess wrong. To check, I grepped an >>>>>>> exploded package for instances of 'Bio::Graphics' and what returned >>>>>>> is >>>>>>> below, at the end of the e-mail. I suspect that the 'use >>>>>>> Bio::Graphics' in some of the installed scripts in bin/ such as >>>>>>> bp_glyphs2-demo.pl are causing the issue. Shouldn't these scripts >>>>>>> perhaps be moved to the Bio::Graphics CPAN module (along with the >>>>>>> scripts in examples/)? >>>>>>> >>>>>>> >>>>>> Thanks for pointing that out. I'll leave it to Chris to sort that >>>>>> out... >>>>>> >>>>>> >>>>> Yes, those scripts should be moved over (already have indicated this to >>>>> Lincoln). I can't check my local svn co (it's sitting about ~1000 >>>>> miles >>>>> away from me in a closet right now). >>>>> >>>>> If the Bio::Graphics is truly not needed, for the moment it is >>>>> >>>>>> possible to also override and filter out the bogus Requires until such >>>>>>> time as these scripts are moved to the appropriate place. >>>>>>> >>>>>>> >>>>>> Great, go ahead and do that if you like. >>>>>> >>>>>> >>>>> I'm not quite sure why we are attempting to RPM package up a release >>>>> candidate unless it's strictly for the purposes of testing things out. >>>>> I >>>>> anticipate the final 1.6 will be out in short period of time (within a >>>>> few >>>>> weeks). Maybe this has already been answered, just haven't had time to >>>>> read >>>>> back along the thread yet. >>>>> >>>>> Anyway, patience everyone. This is an RC not a final release, and I >>>>> anticipated that a few things would probably be screwy. It appears >>>>> only a >>>>> few things need to be addressed and cleaned up prior to a final >>>>> release, so >>>>> overall RC1 did what I wanted (including uncovering an odd PAML bug >>>>> according to CPAN Testers). >>>>> >>>>> -c (from the backwoods in Texas) >>>>> _______________________________________________ >>>>> Bioperl-l mailing list >>>>> Bioperl-l at lists.open-bio.org >>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>>> >>>>> >>>>> >>>> >>>> -- >>>> ------------------------------------------------------------------------ >>>> Scott Cain, Ph. D. scott at scottcain >>>> dot net >>>> GMOD Coordinator (http://gmod.org/) 216-392-3087 >>>> Ontario Institute for Cancer Research >>>> _______________________________________________ >>>> Bioperl-l mailing list >>>> Bioperl-l at lists.open-bio.org >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>> >>>> >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>> >>> >> >> >> -- >> Lincoln D. Stein >> >> Ontario Institute for Cancer Research >> 101 College St., Suite 800 >> Toronto, ON, Canada M5G0A3 >> 416 673-8514 >> Assistant: Renata Musa >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > > -- Lincoln D. Stein Ontario Institute for Cancer Research 101 College St., Suite 800 Toronto, ON, Canada M5G0A3 416 673-8514 Assistant: Renata Musa From lincoln.stein at gmail.com Mon Jan 5 10:36:33 2009 From: lincoln.stein at gmail.com (Lincoln Stein) Date: Mon, 5 Jan 2009 10:36:33 -0500 Subject: [Bioperl-l] Bio::Graphics::DrawTransmembrane Message-ID: <6dce9a0b0901050736p4a4ebea9t6217a2ec8f8e0ccd@mail.gmail.com> Hi Tim, You may or may not know that during the preparation for BioPerl 1.6 we split Bio::Graphics off into its own CPAN distribution and are now hosting its CVS at Sourceforge. During the split, I inadvertently grabbed Bio::Graphics:DrawTransmembrane and moved it into Sourceforge along with the rest of Bio::Graphics. Do you want to maintain Transmembrane out of Sourceforge (I will give you developer access), or move it back into BioPerl for SVN maintenance and release as part of the main Bioperl distribution? Lincoln -- Lincoln D. Stein Ontario Institute for Cancer Research 101 College St., Suite 800 Toronto, ON, Canada M5G0A3 416 673-8514 Assistant: Renata Musa From timnugent at gmail.com Mon Jan 5 11:04:20 2009 From: timnugent at gmail.com (Tim Nugent) Date: Mon, 05 Jan 2009 16:04:20 +0000 Subject: [Bioperl-l] Bio::Graphics::DrawTransmembrane In-Reply-To: <6dce9a0b0901050736p4a4ebea9t6217a2ec8f8e0ccd@mail.gmail.com> References: <6dce9a0b0901050736p4a4ebea9t6217a2ec8f8e0ccd@mail.gmail.com> Message-ID: <49622F84.5080009@gmail.com> Hi Lincoln, I'm not bothered - I'd be happy with either situation, but if it has already been split into Bio::Graphics maybe keep it there? I have one or two other graphics modules that I intended to commit a while back so if you give me dev access I'll add those too. Best wishes, Tim Lincoln Stein wrote: > Hi Tim, > > You may or may not know that during the preparation for BioPerl 1.6 we > split Bio::Graphics off into its own CPAN distribution and are now > hosting its CVS at Sourceforge. During the split, I inadvertently > grabbed Bio::Graphics:DrawTransmembrane and moved it into Sourceforge > along with the rest of Bio::Graphics. > > Do you want to maintain Transmembrane out of Sourceforge (I will give > you developer access), or move it back into BioPerl for SVN maintenance > and release as part of the main Bioperl distribution? > > Lincoln > > -- > Lincoln D. Stein > > Ontario Institute for Cancer Research > 101 College St., Suite 800 > Toronto, ON, Canada M5G0A3 > 416 673-8514 > Assistant: Renata Musa > From cjfields at illinois.edu Mon Jan 5 12:04:20 2009 From: cjfields at illinois.edu (Chris Fields) Date: Mon, 5 Jan 2009 11:04:20 -0600 Subject: [Bioperl-l] Bio::Draw Message-ID: <832B8C14-CFEC-46CA-9479-46B7E3C7515C@illinois.edu> All, We have a couple of modules which were migrated out of core with the Bio::Graphics split which are really independent of Lincoln's various Bio::Graphics modules. Tim Nugent has indicated he will continue developing Bio::Graphics::DrawTransmembrane as well as other Bio::Graphics module on Lincoln's Sourceforge repo. However, we have been unable to contact Shawn Hoon, the author of Bio::Graphics::Pictogram. I have tentatively added this module back to bioperl-live (along with tests) as Bio::Draw::Pictogram per Lincoln's suggestion, but I'm a bit reluctant to merge this to 1.6 until some of the other core devs indicate the namespace is okay. Any objections/comments? chris From MEC at stowers.org Mon Jan 5 14:14:42 2009 From: MEC at stowers.org (Cook, Malcolm) Date: Mon, 5 Jan 2009 13:14:42 -0600 Subject: [Bioperl-l] K-mer generating script In-Reply-To: <0084EA43-1C21-49C0-9E2E-EA9FA838DE9A@illinois.edu> References: <46AC2823CE864DD8BB2926D499FB22E3@NewLife> <3C518A10-A204-418B-BC7D-A5C7EDC3581E@bioperl.org> <0084EA43-1C21-49C0-9E2E-EA9FA838DE9A@illinois.edu> Message-ID: Gang, I couldn't resist adding the following non-perl solution... #!/bin/bash k=$1 s=$( printf "%${k}s" ); # a string with $k blanks s=${s// /{A,T,G,C\}}; # substitute '{A,T,G,C}' for each of the k blanks echo 'kmers using bash to expand:' $s > /dev/stderr bash -c "echo $s"; # let brace expanion of inferior bash compute the cross product -- Malcolm > -----Original Message----- > From: bioperl-l-bounces at lists.open-bio.org > [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of > Chris Fields > Sent: Friday, December 19, 2008 11:54 PM > To: Jason Stajich > Cc: bioperl list; Mark A. Jensen; Blanchette, Marco > Subject: Re: [Bioperl-l] K-mer generating script > > To add to the pile: > > Mark-Jason Dominus tackles this problem in Higher-Order Perl > using iterators, which also allows other nifty bits like > 'give variants of A(CTG)T(TGA)', where anything in > parentheses are wild-cards. The nice advantage of the > iterator approach is you don't tank memory for long strings. > Furthermore, as a bonus, you can now download the book for > free: > > http://hop.perl.plover.com/book/ > > The relevant chapter is here (p. 135): > > http://hop.perl.plover.com/book/pdf/04Iterators.pdf > > chris > > On Dec 19, 2008, at 11:02 PM, Jason Stajich wrote: > > > Does someone want to put this on the wiki too? > > > > Maybe we could start a little bit of perl snippets for > examples like > > these. > > > > -j > > On Dec 19, 2008, at 7:45 PM, Mark A. Jensen wrote: > > > >> A little sloppy, but it recurses and is general--- > >> > >> # ex... > >> @combs = doit(3, [ qw( A T G C ) ]); > >> 1; > >> # code > >> > >> sub doit { > >> my ($n, $sym) = @_; > >> my $a = []; > >> doit_guts($n, $sym, $a, ''); > >> return map {$_ || ()} @$a; > >> } > >> > >> sub doit_guts { > >> my ($n, $sym, $store, $str) = @_; > >> if (!$n) { > >> return $str; > >> } > >> else { > >> foreach my $s (@$sym) { > >> push @$store, doit_guts($n-1, $sym, $store, $str.$s); } } } > >> > >> > >> ----- Original Message ----- From: "Blanchette, Marco" > >> >> > > >> To: > >> Sent: Friday, December 19, 2008 6:25 PM > >> Subject: [Bioperl-l] K-mer generating script > >> > >> > >>> Dear all, > >>> > >>> Does anyone have a little function that I could use to > generate all > >>> possible k-mer DNA sequences? For instance all possible > 3-mer (AAA, > >>> AAT, AAC, AAG, etc...). I need something that I could input the > >>> value of k and get all possible sequences... > >>> > >>> I know that it's a problem that need to use recursive programming > >>> but I can't get my brain around the problem. > >>> > >>> Many thanks > >>> > >>> Marco > >>> -- > >>> Marco Blanchette, Ph.D. > >>> Assistant Investigator > >>> Stowers Institute for Medical Research 1000 East 50th St. > >>> > >>> Kansas City, MO 64110 > >>> > >>> Tel: 816-926-4071 > >>> Cell: 816-726-8419 > >>> Fax: 816-926-2018 > >>> > >>> _______________________________________________ > >>> Bioperl-l mailing list > >>> Bioperl-l at lists.open-bio.org > >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l > >>> > >> > >> _______________________________________________ > >> Bioperl-l mailing list > >> Bioperl-l at lists.open-bio.org > >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > > > > Jason Stajich > > jason at bioperl.org > > > > > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > From Russell.Smithies at agresearch.co.nz Mon Jan 5 15:43:32 2009 From: Russell.Smithies at agresearch.co.nz (Smithies, Russell) Date: Tue, 6 Jan 2009 09:43:32 +1300 Subject: [Bioperl-l] K-mer generating script In-Reply-To: References: <46AC2823CE864DD8BB2926D499FB22E3@NewLife> <3C518A10-A204-418B-BC7D-A5C7EDC3581E@bioperl.org> <0084EA43-1C21-49C0-9E2E-EA9FA838DE9A@illinois.edu> Message-ID: <18DF7D20DFEC044098A1062202F5FFF31A69523ED6@exchsth.agresearch.co.nz> Yet another way with recursive use of map: print "[", join(", ", @$_), "]\n" for permute([ qw( A T G C ) ],[ qw( A T G C ) ],[ qw( A T G C ) ],[ qw( A T G C ) ]); sub permute { my $last = pop @_; unless (@_) { return map [$_], @$last; } return map { my $left = $_; map [@$left, $_], @$last } permute(@_); } (Modified from a PerlMonks example http://perlmonks.org/?node_id=24270) > -----Original Message----- > From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l- > bounces at lists.open-bio.org] On Behalf Of Cook, Malcolm > Sent: Tuesday, 6 January 2009 8:15 a.m. > To: 'Chris Fields'; 'Jason Stajich' > Cc: 'bioperl list'; 'Mark A. Jensen'; Blanchette, Marco > Subject: Re: [Bioperl-l] K-mer generating script > > Gang, > > I couldn't resist adding the following non-perl solution... > > #!/bin/bash > k=$1 > s=$( printf "%${k}s" ); # a string with $k blanks > s=${s// /{A,T,G,C\}}; # substitute '{A,T,G,C}' for each of the k > blanks > echo 'kmers using bash to expand:' $s > /dev/stderr > bash -c "echo $s"; # let brace expanion of inferior bash compute > the cross product > > -- Malcolm > > > > -----Original Message----- > > From: bioperl-l-bounces at lists.open-bio.org > > [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of > > Chris Fields > > Sent: Friday, December 19, 2008 11:54 PM > > To: Jason Stajich > > Cc: bioperl list; Mark A. Jensen; Blanchette, Marco > > Subject: Re: [Bioperl-l] K-mer generating script > > > > To add to the pile: > > > > Mark-Jason Dominus tackles this problem in Higher-Order Perl > > using iterators, which also allows other nifty bits like > > 'give variants of A(CTG)T(TGA)', where anything in > > parentheses are wild-cards. The nice advantage of the > > iterator approach is you don't tank memory for long strings. > > Furthermore, as a bonus, you can now download the book for > > free: > > > > http://hop.perl.plover.com/book/ > > > > The relevant chapter is here (p. 135): > > > > http://hop.perl.plover.com/book/pdf/04Iterators.pdf > > > > chris > > > > On Dec 19, 2008, at 11:02 PM, Jason Stajich wrote: > > > > > Does someone want to put this on the wiki too? > > > > > > Maybe we could start a little bit of perl snippets for > > examples like > > > these. > > > > > > -j > > > On Dec 19, 2008, at 7:45 PM, Mark A. Jensen wrote: > > > > > >> A little sloppy, but it recurses and is general--- > > >> > > >> # ex... > > >> @combs = doit(3, [ qw( A T G C ) ]); > > >> 1; > > >> # code > > >> > > >> sub doit { > > >> my ($n, $sym) = @_; > > >> my $a = []; > > >> doit_guts($n, $sym, $a, ''); > > >> return map {$_ || ()} @$a; > > >> } > > >> > > >> sub doit_guts { > > >> my ($n, $sym, $store, $str) = @_; > > >> if (!$n) { > > >> return $str; > > >> } > > >> else { > > >> foreach my $s (@$sym) { > > >> push @$store, doit_guts($n-1, $sym, $store, $str.$s); } } } > > >> > > >> > > >> ----- Original Message ----- From: "Blanchette, Marco" > > >> > >> > > > >> To: > > >> Sent: Friday, December 19, 2008 6:25 PM > > >> Subject: [Bioperl-l] K-mer generating script > > >> > > >> > > >>> Dear all, > > >>> > > >>> Does anyone have a little function that I could use to > > generate all > > >>> possible k-mer DNA sequences? For instance all possible > > 3-mer (AAA, > > >>> AAT, AAC, AAG, etc...). I need something that I could input the > > >>> value of k and get all possible sequences... > > >>> > > >>> I know that it's a problem that need to use recursive programming > > >>> but I can't get my brain around the problem. > > >>> > > >>> Many thanks > > >>> > > >>> Marco > > >>> -- > > >>> Marco Blanchette, Ph.D. > > >>> Assistant Investigator > > >>> Stowers Institute for Medical Research 1000 East 50th St. > > >>> > > >>> Kansas City, MO 64110 > > >>> > > >>> Tel: 816-926-4071 > > >>> Cell: 816-726-8419 > > >>> Fax: 816-926-2018 > > >>> > > >>> _______________________________________________ > > >>> Bioperl-l mailing list > > >>> Bioperl-l at lists.open-bio.org > > >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l > > >>> > > >> > > >> _______________________________________________ > > >> Bioperl-l mailing list > > >> Bioperl-l at lists.open-bio.org > > >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > > > > > > Jason Stajich > > > jason at bioperl.org > > > > > > > > > > > > _______________________________________________ > > > Bioperl-l mailing list > > > Bioperl-l at lists.open-bio.org > > > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l ======================================================================= Attention: The information contained in this message and/or attachments from AgResearch Limited is intended only for the persons or entities to which it is addressed and may contain confidential and/or privileged material. Any review, retransmission, dissemination or other use of, or taking of any action in reliance upon, this information by persons or entities other than the intended recipients is prohibited by AgResearch Limited. If you have received this message in error, please notify the sender immediately. ======================================================================= From cjfields at illinois.edu Mon Jan 5 16:45:33 2009 From: cjfields at illinois.edu (Chris Fields) Date: Mon, 5 Jan 2009 15:45:33 -0600 Subject: [Bioperl-l] K-mer generating script In-Reply-To: <18DF7D20DFEC044098A1062202F5FFF31A69523ED6@exchsth.agresearch.co.nz> References: <46AC2823CE864DD8BB2926D499FB22E3@NewLife> <3C518A10-A204-418B-BC7D-A5C7EDC3581E@bioperl.org> <0084EA43-1C21-49C0-9E2E-EA9FA838DE9A@illinois.edu> <18DF7D20DFEC044098A1062202F5FFF31A69523ED6@exchsth.agresearch.co.nz> Message-ID: Perl 6 (20 random 20-mers): use v6; say [~] .pick(20, :repl) for 1..20; -chris On Jan 5, 2009, at 2:43 PM, Smithies, Russell wrote: > Yet another way with recursive use of map: > > print "[", join(", ", @$_), "]\n" for > permute([ qw( A T G C ) ],[ qw( A T G C ) ],[ qw( A T G C ) ], > [ qw( A T G C ) ]); > > sub permute { > my $last = pop @_; > unless (@_) { > return map [$_], @$last; > } > return map { my $left = $_; map [@$left, $_], @$last } permute(@_); > } > > > (Modified from a PerlMonks example http://perlmonks.org/? > node_id=24270) > > >> -----Original Message----- >> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l- >> bounces at lists.open-bio.org] On Behalf Of Cook, Malcolm >> Sent: Tuesday, 6 January 2009 8:15 a.m. >> To: 'Chris Fields'; 'Jason Stajich' >> Cc: 'bioperl list'; 'Mark A. Jensen'; Blanchette, Marco >> Subject: Re: [Bioperl-l] K-mer generating script >> >> Gang, >> >> I couldn't resist adding the following non-perl solution... >> >> #!/bin/bash >> k=$1 >> s=$( printf "%${k}s" ); # a string with $k blanks >> s=${s// /{A,T,G,C\}}; # substitute '{A,T,G,C}' for each of the k >> blanks >> echo 'kmers using bash to expand:' $s > /dev/stderr >> bash -c "echo $s"; # let brace expanion of inferior bash compute >> the cross product >> >> -- Malcolm >> >> >>> -----Original Message----- >>> From: bioperl-l-bounces at lists.open-bio.org >>> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of >>> Chris Fields >>> Sent: Friday, December 19, 2008 11:54 PM >>> To: Jason Stajich >>> Cc: bioperl list; Mark A. Jensen; Blanchette, Marco >>> Subject: Re: [Bioperl-l] K-mer generating script >>> >>> To add to the pile: >>> >>> Mark-Jason Dominus tackles this problem in Higher-Order Perl >>> using iterators, which also allows other nifty bits like >>> 'give variants of A(CTG)T(TGA)', where anything in >>> parentheses are wild-cards. The nice advantage of the >>> iterator approach is you don't tank memory for long strings. >>> Furthermore, as a bonus, you can now download the book for >>> free: >>> >>> http://hop.perl.plover.com/book/ >>> >>> The relevant chapter is here (p. 135): >>> >>> http://hop.perl.plover.com/book/pdf/04Iterators.pdf >>> >>> chris >>> >>> On Dec 19, 2008, at 11:02 PM, Jason Stajich wrote: >>> >>>> Does someone want to put this on the wiki too? >>>> >>>> Maybe we could start a little bit of perl snippets for >>> examples like >>>> these. >>>> >>>> -j >>>> On Dec 19, 2008, at 7:45 PM, Mark A. Jensen wrote: >>>> >>>>> A little sloppy, but it recurses and is general--- >>>>> >>>>> # ex... >>>>> @combs = doit(3, [ qw( A T G C ) ]); >>>>> 1; >>>>> # code >>>>> >>>>> sub doit { >>>>> my ($n, $sym) = @_; >>>>> my $a = []; >>>>> doit_guts($n, $sym, $a, ''); >>>>> return map {$_ || ()} @$a; >>>>> } >>>>> >>>>> sub doit_guts { >>>>> my ($n, $sym, $store, $str) = @_; >>>>> if (!$n) { >>>>> return $str; >>>>> } >>>>> else { >>>>> foreach my $s (@$sym) { >>>>> push @$store, doit_guts($n-1, $sym, $store, $str.$s); } } } >>>>> >>>>> >>>>> ----- Original Message ----- From: "Blanchette, Marco" >>>>> >>>>> >>>>> To: >>>>> Sent: Friday, December 19, 2008 6:25 PM >>>>> Subject: [Bioperl-l] K-mer generating script >>>>> >>>>> >>>>>> Dear all, >>>>>> >>>>>> Does anyone have a little function that I could use to >>> generate all >>>>>> possible k-mer DNA sequences? For instance all possible >>> 3-mer (AAA, >>>>>> AAT, AAC, AAG, etc...). I need something that I could input the >>>>>> value of k and get all possible sequences... >>>>>> >>>>>> I know that it's a problem that need to use recursive programming >>>>>> but I can't get my brain around the problem. >>>>>> >>>>>> Many thanks >>>>>> >>>>>> Marco >>>>>> -- >>>>>> Marco Blanchette, Ph.D. >>>>>> Assistant Investigator >>>>>> Stowers Institute for Medical Research 1000 East 50th St. >>>>>> >>>>>> Kansas City, MO 64110 >>>>>> >>>>>> Tel: 816-926-4071 >>>>>> Cell: 816-726-8419 >>>>>> Fax: 816-926-2018 >>>>>> >>>>>> _______________________________________________ >>>>>> Bioperl-l mailing list >>>>>> Bioperl-l at lists.open-bio.org >>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>>>> >>>>> >>>>> _______________________________________________ >>>>> Bioperl-l mailing list >>>>> Bioperl-l at lists.open-bio.org >>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>> >>>> Jason Stajich >>>> jason at bioperl.org >>>> >>>> >>>> >>>> _______________________________________________ >>>> Bioperl-l mailing list >>>> Bioperl-l at lists.open-bio.org >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>> >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>> >> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > = > ====================================================================== > Attention: The information contained in this message and/or > attachments > from AgResearch Limited is intended only for the persons or entities > to which it is addressed and may contain confidential and/or > privileged > material. Any review, retransmission, dissemination or other use of, > or > taking of any action in reliance upon, this information by persons or > entities other than the intended recipients is prohibited by > AgResearch > Limited. If you have received this message in error, please notify the > sender immediately. > = > ====================================================================== > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From maj at fortinbras.us Mon Jan 5 16:44:23 2009 From: maj at fortinbras.us (Mark A. Jensen) Date: Mon, 5 Jan 2009 16:44:23 -0500 Subject: [Bioperl-l] K-mer generating script In-Reply-To: <18DF7D20DFEC044098A1062202F5FFF31A69523ED6@exchsth.agresearch.co.nz> References: <46AC2823CE864DD8BB2926D499FB22E3@NewLife><3C518A10-A204-418B-BC7D-A5C7EDC3581E@bioperl.org><0084EA43-1C21-49C0-9E2E-EA9FA838DE9A@illinois.edu> <18DF7D20DFEC044098A1062202F5FFF31A69523ED6@exchsth.agresearch.co.nz> Message-ID: <1DF34D01BE974B5DBE2DCB462ABDA80A@NewLife> Malcolm, Russell-- excellent! MAJ ----- Original Message ----- From: "Smithies, Russell" To: "'bioperl list'" Sent: Monday, January 05, 2009 3:43 PM Subject: Re: [Bioperl-l] K-mer generating script > Yet another way with recursive use of map: > > print "[", join(", ", @$_), "]\n" for > permute([ qw( A T G C ) ],[ qw( A T G C ) ],[ qw( A T G C ) ],[ qw( A T G > C ) ]); > > sub permute { > my $last = pop @_; > unless (@_) { > return map [$_], @$last; > } > return map { my $left = $_; map [@$left, $_], @$last } permute(@_); > } > > > (Modified from a PerlMonks example http://perlmonks.org/?node_id=24270) > > >> -----Original Message----- >> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l- >> bounces at lists.open-bio.org] On Behalf Of Cook, Malcolm >> Sent: Tuesday, 6 January 2009 8:15 a.m. >> To: 'Chris Fields'; 'Jason Stajich' >> Cc: 'bioperl list'; 'Mark A. Jensen'; Blanchette, Marco >> Subject: Re: [Bioperl-l] K-mer generating script >> >> Gang, >> >> I couldn't resist adding the following non-perl solution... >> >> #!/bin/bash >> k=$1 >> s=$( printf "%${k}s" ); # a string with $k blanks >> s=${s// /{A,T,G,C\}}; # substitute '{A,T,G,C}' for each of the k >> blanks >> echo 'kmers using bash to expand:' $s > /dev/stderr >> bash -c "echo $s"; # let brace expanion of inferior bash compute >> the cross product >> >> -- Malcolm >> >> >> > -----Original Message----- >> > From: bioperl-l-bounces at lists.open-bio.org >> > [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of >> > Chris Fields >> > Sent: Friday, December 19, 2008 11:54 PM >> > To: Jason Stajich >> > Cc: bioperl list; Mark A. Jensen; Blanchette, Marco >> > Subject: Re: [Bioperl-l] K-mer generating script >> > >> > To add to the pile: >> > >> > Mark-Jason Dominus tackles this problem in Higher-Order Perl >> > using iterators, which also allows other nifty bits like >> > 'give variants of A(CTG)T(TGA)', where anything in >> > parentheses are wild-cards. The nice advantage of the >> > iterator approach is you don't tank memory for long strings. >> > Furthermore, as a bonus, you can now download the book for >> > free: >> > >> > http://hop.perl.plover.com/book/ >> > >> > The relevant chapter is here (p. 135): >> > >> > http://hop.perl.plover.com/book/pdf/04Iterators.pdf >> > >> > chris >> > >> > On Dec 19, 2008, at 11:02 PM, Jason Stajich wrote: >> > >> > > Does someone want to put this on the wiki too? >> > > >> > > Maybe we could start a little bit of perl snippets for >> > examples like >> > > these. >> > > >> > > -j >> > > On Dec 19, 2008, at 7:45 PM, Mark A. Jensen wrote: >> > > >> > >> A little sloppy, but it recurses and is general--- >> > >> >> > >> # ex... >> > >> @combs = doit(3, [ qw( A T G C ) ]); >> > >> 1; >> > >> # code >> > >> >> > >> sub doit { >> > >> my ($n, $sym) = @_; >> > >> my $a = []; >> > >> doit_guts($n, $sym, $a, ''); >> > >> return map {$_ || ()} @$a; >> > >> } >> > >> >> > >> sub doit_guts { >> > >> my ($n, $sym, $store, $str) = @_; >> > >> if (!$n) { >> > >> return $str; >> > >> } >> > >> else { >> > >> foreach my $s (@$sym) { >> > >> push @$store, doit_guts($n-1, $sym, $store, $str.$s); } } } >> > >> >> > >> >> > >> ----- Original Message ----- From: "Blanchette, Marco" >> > >> > > >> > >> > >> To: >> > >> Sent: Friday, December 19, 2008 6:25 PM >> > >> Subject: [Bioperl-l] K-mer generating script >> > >> >> > >> >> > >>> Dear all, >> > >>> >> > >>> Does anyone have a little function that I could use to >> > generate all >> > >>> possible k-mer DNA sequences? For instance all possible >> > 3-mer (AAA, >> > >>> AAT, AAC, AAG, etc...). I need something that I could input the >> > >>> value of k and get all possible sequences... >> > >>> >> > >>> I know that it's a problem that need to use recursive programming >> > >>> but I can't get my brain around the problem. >> > >>> >> > >>> Many thanks >> > >>> >> > >>> Marco >> > >>> -- >> > >>> Marco Blanchette, Ph.D. >> > >>> Assistant Investigator >> > >>> Stowers Institute for Medical Research 1000 East 50th St. >> > >>> >> > >>> Kansas City, MO 64110 >> > >>> >> > >>> Tel: 816-926-4071 >> > >>> Cell: 816-726-8419 >> > >>> Fax: 816-926-2018 >> > >>> >> > >>> _______________________________________________ >> > >>> Bioperl-l mailing list >> > >>> Bioperl-l at lists.open-bio.org >> > >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > >>> >> > >> >> > >> _______________________________________________ >> > >> Bioperl-l mailing list >> > >> Bioperl-l at lists.open-bio.org >> > >> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > > >> > > Jason Stajich >> > > jason at bioperl.org >> > > >> > > >> > > >> > > _______________________________________________ >> > > Bioperl-l mailing list >> > > Bioperl-l at lists.open-bio.org >> > > http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > >> > _______________________________________________ >> > Bioperl-l mailing list >> > Bioperl-l at lists.open-bio.org >> > http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > >> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > ======================================================================= > Attention: The information contained in this message and/or attachments > from AgResearch Limited is intended only for the persons or entities > to which it is addressed and may contain confidential and/or privileged > material. Any review, retransmission, dissemination or other use of, or > taking of any action in reliance upon, this information by persons or > entities other than the intended recipients is prohibited by AgResearch > Limited. If you have received this message in error, please notify the > sender immediately. > ======================================================================= > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > From hlapp at gmx.net Mon Jan 5 17:00:28 2009 From: hlapp at gmx.net (Hilmar Lapp) Date: Mon, 5 Jan 2009 17:00:28 -0500 Subject: [Bioperl-l] Bio::Draw In-Reply-To: <832B8C14-CFEC-46CA-9479-46B7E3C7515C@illinois.edu> References: <832B8C14-CFEC-46CA-9479-46B7E3C7515C@illinois.edu> Message-ID: On Jan 5, 2009, at 12:04 PM, Chris Fields wrote: > the namespace [Bio::Draw] Any objections/comments? Sounds good to me, though it also looks like this would become its own module? (bioperl-draw? would that be big enough to warrant its own?) -hilmar -- =========================================================== : Hilmar Lapp -:- Durham, NC -:- hlapp at gmx dot net : =========================================================== From Russell.Smithies at agresearch.co.nz Mon Jan 5 17:03:23 2009 From: Russell.Smithies at agresearch.co.nz (Smithies, Russell) Date: Tue, 6 Jan 2009 11:03:23 +1300 Subject: [Bioperl-l] K-mer generating script In-Reply-To: References: <46AC2823CE864DD8BB2926D499FB22E3@NewLife> <3C518A10-A204-418B-BC7D-A5C7EDC3581E@bioperl.org> <0084EA43-1C21-49C0-9E2E-EA9FA838DE9A@illinois.edu> <18DF7D20DFEC044098A1062202F5FFF31A69523ED6@exchsth.agresearch.co.nz> Message-ID: <18DF7D20DFEC044098A1062202F5FFF31A69523EE1@exchsth.agresearch.co.nz> Aaarrgg, it's starting to look like some bastard child of Python and Haskell!!! ;-) > -----Original Message----- > From: Chris Fields [mailto:cjfields at illinois.edu] > Sent: Tuesday, 6 January 2009 10:46 a.m. > To: Smithies, Russell > Cc: 'bioperl list' > Subject: Re: [Bioperl-l] K-mer generating script > > Perl 6 (20 random 20-mers): > > use v6; > > say [~] .pick(20, :repl) for 1..20; > > -chris > > On Jan 5, 2009, at 2:43 PM, Smithies, Russell wrote: > > > Yet another way with recursive use of map: > > > > print "[", join(", ", @$_), "]\n" for > > permute([ qw( A T G C ) ],[ qw( A T G C ) ],[ qw( A T G C ) ], > > [ qw( A T G C ) ]); > > > > sub permute { > > my $last = pop @_; > > unless (@_) { > > return map [$_], @$last; > > } > > return map { my $left = $_; map [@$left, $_], @$last } permute(@_); > > } > > > > > > (Modified from a PerlMonks example http://perlmonks.org/? > > node_id=24270) > > > > > >> -----Original Message----- > >> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l- > >> bounces at lists.open-bio.org] On Behalf Of Cook, Malcolm > >> Sent: Tuesday, 6 January 2009 8:15 a.m. > >> To: 'Chris Fields'; 'Jason Stajich' > >> Cc: 'bioperl list'; 'Mark A. Jensen'; Blanchette, Marco > >> Subject: Re: [Bioperl-l] K-mer generating script > >> > >> Gang, > >> > >> I couldn't resist adding the following non-perl solution... > >> > >> #!/bin/bash > >> k=$1 > >> s=$( printf "%${k}s" ); # a string with $k blanks > >> s=${s// /{A,T,G,C\}}; # substitute '{A,T,G,C}' for each of the k > >> blanks > >> echo 'kmers using bash to expand:' $s > /dev/stderr > >> bash -c "echo $s"; # let brace expanion of inferior bash > compute > >> the cross product > >> > >> -- Malcolm > >> > >> > >>> -----Original Message----- > >>> From: bioperl-l-bounces at lists.open-bio.org > >>> [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of > >>> Chris Fields > >>> Sent: Friday, December 19, 2008 11:54 PM > >>> To: Jason Stajich > >>> Cc: bioperl list; Mark A. Jensen; Blanchette, Marco > >>> Subject: Re: [Bioperl-l] K-mer generating script > >>> > >>> To add to the pile: > >>> > >>> Mark-Jason Dominus tackles this problem in Higher-Order Perl > >>> using iterators, which also allows other nifty bits like > >>> 'give variants of A(CTG)T(TGA)', where anything in > >>> parentheses are wild-cards. The nice advantage of the > >>> iterator approach is you don't tank memory for long strings. > >>> Furthermore, as a bonus, you can now download the book for > >>> free: > >>> > >>> http://hop.perl.plover.com/book/ > >>> > >>> The relevant chapter is here (p. 135): > >>> > >>> http://hop.perl.plover.com/book/pdf/04Iterators.pdf > >>> > >>> chris > >>> > >>> On Dec 19, 2008, at 11:02 PM, Jason Stajich wrote: > >>> > >>>> Does someone want to put this on the wiki too? > >>>> > >>>> Maybe we could start a little bit of perl snippets for > >>> examples like > >>>> these. > >>>> > >>>> -j > >>>> On Dec 19, 2008, at 7:45 PM, Mark A. Jensen wrote: > >>>> > >>>>> A little sloppy, but it recurses and is general--- > >>>>> > >>>>> # ex... > >>>>> @combs = doit(3, [ qw( A T G C ) ]); > >>>>> 1; > >>>>> # code > >>>>> > >>>>> sub doit { > >>>>> my ($n, $sym) = @_; > >>>>> my $a = []; > >>>>> doit_guts($n, $sym, $a, ''); > >>>>> return map {$_ || ()} @$a; > >>>>> } > >>>>> > >>>>> sub doit_guts { > >>>>> my ($n, $sym, $store, $str) = @_; > >>>>> if (!$n) { > >>>>> return $str; > >>>>> } > >>>>> else { > >>>>> foreach my $s (@$sym) { > >>>>> push @$store, doit_guts($n-1, $sym, $store, $str.$s); } } } > >>>>> > >>>>> > >>>>> ----- Original Message ----- From: "Blanchette, Marco" > >>>>> >>>>>> > >>>>> To: > >>>>> Sent: Friday, December 19, 2008 6:25 PM > >>>>> Subject: [Bioperl-l] K-mer generating script > >>>>> > >>>>> > >>>>>> Dear all, > >>>>>> > >>>>>> Does anyone have a little function that I could use to > >>> generate all > >>>>>> possible k-mer DNA sequences? For instance all possible > >>> 3-mer (AAA, > >>>>>> AAT, AAC, AAG, etc...). I need something that I could input the > >>>>>> value of k and get all possible sequences... > >>>>>> > >>>>>> I know that it's a problem that need to use recursive > programming > >>>>>> but I can't get my brain around the problem. > >>>>>> > >>>>>> Many thanks > >>>>>> > >>>>>> Marco > >>>>>> -- > >>>>>> Marco Blanchette, Ph.D. > >>>>>> Assistant Investigator > >>>>>> Stowers Institute for Medical Research 1000 East 50th St. > >>>>>> > >>>>>> Kansas City, MO 64110 > >>>>>> > >>>>>> Tel: 816-926-4071 > >>>>>> Cell: 816-726-8419 > >>>>>> Fax: 816-926-2018 > >>>>>> > >>>>>> _______________________________________________ > >>>>>> Bioperl-l mailing list > >>>>>> Bioperl-l at lists.open-bio.org > >>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l > >>>>>> > >>>>> > >>>>> _______________________________________________ > >>>>> Bioperl-l mailing list > >>>>> Bioperl-l at lists.open-bio.org > >>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l > >>>> > >>>> Jason Stajich > >>>> jason at bioperl.org > >>>> > >>>> > >>>> > >>>> _______________________________________________ > >>>> Bioperl-l mailing list > >>>> Bioperl-l at lists.open-bio.org > >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l > >>> > >>> _______________________________________________ > >>> Bioperl-l mailing list > >>> Bioperl-l at lists.open-bio.org > >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l > >>> > >> > >> _______________________________________________ > >> Bioperl-l mailing list > >> Bioperl-l at lists.open-bio.org > >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > > = > > > ====================================================================== > > Attention: The information contained in this message and/or > > attachments > > from AgResearch Limited is intended only for the persons or entities > > to which it is addressed and may contain confidential and/or > > privileged > > material. Any review, retransmission, dissemination or other use of, > > or > > taking of any action in reliance upon, this information by persons or > > entities other than the intended recipients is prohibited by > > AgResearch > > Limited. If you have received this message in error, please notify > the > > sender immediately. > > = > > > ====================================================================== > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/bioperl-l ======================================================================= Attention: The information contained in this message and/or attachments from AgResearch Limited is intended only for the persons or entities to which it is addressed and may contain confidential and/or privileged material. Any review, retransmission, dissemination or other use of, or taking of any action in reliance upon, this information by persons or entities other than the intended recipients is prohibited by AgResearch Limited. If you have received this message in error, please notify the sender immediately. ======================================================================= From abhishek.vit at gmail.com Mon Jan 5 17:09:05 2009 From: abhishek.vit at gmail.com (Abhishek Pratap) Date: Mon, 5 Jan 2009 17:09:05 -0500 Subject: [Bioperl-l] Basic Error with Bio::Assembly:IO Message-ID: Hi All I am new to Bio::Assembly and the way it is implemented. I am simply reading an ACE file and getting an error . here is the script Can't call method "get_consensus_sequence" on an undefined value at /usr/lib/perl5/vendor_perl/5.8.8/Bio/Assembly/IO/ace.pm line 167, line 163. Here is the script . ========== #!/usr/local/bin/perl -w my $PROGNAME="$0"; #my ($infile, $io, $usage ###Required Modules use strict; use Bio::Assembly::IO; use Bio::AlignIO; use Bio::SeqIO; my $usage = <new(-file=>"$infile", -format=>"ace"); #print "IO is $io\n "; my $assembly=$io->next_assembly(); ### Pointing to Bio::Assembly::Scaffold1 #print "Assembly : $assembly"; foreach my $contig ($assembly->all_contigs()) ##Bio::Assembly::Contig { my $contigName=$contig->id; print "Contig Name is \t $contigName"; } =========== -- ----------------------------- Abhishek Pratap Bioinformatics Software Engineer Institute for Genome Sciences School of Medicine, Univ of Maryland 801, W. Baltimore Street, Baltimore, MD 21209 Ph: (+1)-410-706-2296 www.igs.umaryland.edu/ Chair RSG-Worldwide ISCB-Student Council http://iscbsc.org/rsg www.bioinfosolutions.com From Russell.Smithies at agresearch.co.nz Mon Jan 5 17:24:06 2009 From: Russell.Smithies at agresearch.co.nz (Smithies, Russell) Date: Tue, 6 Jan 2009 11:24:06 +1300 Subject: [Bioperl-l] Basic Error with Bio::Assembly:IO In-Reply-To: References: Message-ID: <18DF7D20DFEC044098A1062202F5FFF31A69523EE3@exchsth.agresearch.co.nz> Have a look in your .ace file and check the contig name. I think the regex in the old ace.pm was a bit too specific and would only read files with contigs named Contig1, Contig2, etc.. so if your contig is named "contig1" it will fail. A quick hack if you only have a few files to do is rename the contigs in your .ace file. Or tweak the regex at line 142 in ace.pm Russell > -----Original Message----- > From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l- > bounces at lists.open-bio.org] On Behalf Of Abhishek Pratap > Sent: Tuesday, 6 January 2009 11:09 a.m. > To: bioperl-l at lists.open-bio.org > Subject: [Bioperl-l] Basic Error with Bio::Assembly:IO > > Hi All > > I am new to Bio::Assembly and the way it is implemented. I am simply > reading > an ACE file and getting an error . > here is the script > > > Can't call method "get_consensus_sequence" on an undefined value at > /usr/lib/perl5/vendor_perl/5.8.8/Bio/Assembly/IO/ace.pm line 167, > > line 163. > > > Here is the script . > > > ========== > > #!/usr/local/bin/perl -w > > my $PROGNAME="$0"; > > #my ($infile, $io, $usage > > > ###Required Modules > use strict; > use Bio::Assembly::IO; > use Bio::AlignIO; > use Bio::SeqIO; > > my $usage = < > $PROGNAME {acefile name with full path} > > USAGE > > > my $infile = shift or die $usage; > > my $io = Bio::Assembly::IO->new(-file=>"$infile", -format=>"ace"); > > #print "IO is $io\n "; > > my $assembly=$io->next_assembly(); ### Pointing to > Bio::Assembly::Scaffold1 > > #print "Assembly : $assembly"; > > foreach my $contig ($assembly->all_contigs()) ##Bio::Assembly::Contig > > > { > > > my $contigName=$contig->id; > print "Contig Name is \t $contigName"; > > } > > > > > > > > > > > =========== > > > > -- > ----------------------------- > Abhishek Pratap > Bioinformatics Software Engineer > Institute for Genome Sciences > School of Medicine, Univ of Maryland > 801, W. Baltimore Street, Baltimore, MD 21209 > Ph: (+1)-410-706-2296 > www.igs.umaryland.edu/ > > Chair > RSG-Worldwide > ISCB-Student Council > http://iscbsc.org/rsg > > www.bioinfosolutions.com > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l ======================================================================= Attention: The information contained in this message and/or attachments from AgResearch Limited is intended only for the persons or entities to which it is addressed and may contain confidential and/or privileged material. Any review, retransmission, dissemination or other use of, or taking of any action in reliance upon, this information by persons or entities other than the intended recipients is prohibited by AgResearch Limited. If you have received this message in error, please notify the sender immediately. ======================================================================= From cjfields at illinois.edu Mon Jan 5 19:37:01 2009 From: cjfields at illinois.edu (Chris Fields) Date: Mon, 5 Jan 2009 18:37:01 -0600 Subject: [Bioperl-l] Bio::Draw In-Reply-To: References: <832B8C14-CFEC-46CA-9479-46B7E3C7515C@illinois.edu> Message-ID: <6DD71814-5E8A-41F8-A749-97B7662DF6A9@illinois.edu> On Jan 5, 2009, at 4:00 PM, Hilmar Lapp wrote: > > On Jan 5, 2009, at 12:04 PM, Chris Fields wrote: > >> the namespace [Bio::Draw] Any objections/comments? > > > Sounds good to me, though it also looks like this would become its > own module? (bioperl-draw? would that be big enough to warrant its > own?) > > -hilmar We already have a possible second one for this namespace just submitted to bugzilla, so I say that's a distinct possibility. chris From shawnh at gmail.com Mon Jan 5 21:41:31 2009 From: shawnh at gmail.com (Shawn Hoon) Date: Tue, 6 Jan 2009 10:41:31 +0800 Subject: [Bioperl-l] Bio::Graphics::Pictogram In-Reply-To: <6dce9a0b0901050734jf93ac87k5293f42ca89841a2@mail.gmail.com> References: <6dce9a0b0901050734jf93ac87k5293f42ca89841a2@mail.gmail.com> Message-ID: hi Lincoln, I no longer maintain Pictogram actively and from the log it has not been worked on for a while as far as I can tell. I would leave it up to bioperl as to whether it should still be maintained via SVN or be deprecated. cheers, shawn On Jan 5, 2009, at 11:34 PM, Lincoln Stein wrote: > Hi Shawn, > > You may or may not know that during the preparation for BioPerl 1.6 > we split > Bio::Graphics off into its own CPAN distribution and are now > hosting its CVS > at Sourceforge. During the split, I inadvertently grabbed > Bio::Graphics::Pictogram and moved it into Sourceforge along with > the rest > of Bio::Graphics. > > Do you want to maintain Pictogram out of Sourceforge (I will give you > developer access), or move it back into BioPerl for SVN maintenance > and > release as part of the main Bioperl distribution? > > Lincoln > > On Sat, Jan 3, 2009 at 12:39 PM, Chris Fields > wrote: > >> Lincoln, >> >> There were several scripts and examples in bioperl-live which have >> been >> removed but somehow persisted in the branch and were in 1.6 RC1 (a >> test also >> remained which was also removed, t/Graphics/Pictogram.t). I >> didn't know if >> you wanted these moved to Sourceforge; I saw there were several >> examples >> already in the Bio::Graphics repository. >> >> There were a few other modules in Bio::Graphics namespace moved >> over to >> Sourceforge that I wasn't sure whether you wanted to maintain, >> such as >> DrawTransmembrane.pm and Pictogram.pm. If needed we can resurrect >> them in >> trunk, under either Bio::Graphics or a different namespace (latter is >> probably better, any suggestions?). They don't appear to rely on >> other >> Bio::Graphics modules directly. >> >> chris >> >> >> On Jan 3, 2009, at 9:51 AM, Lincoln Stein wrote: >> >> Sorry, what's the question? Anything having to do with >> biographics should >>> be >>> removed as it now has its own separately installable CPAN module. >>> >>> Lincoln >>> >>> On Fri, Jan 2, 2009 at 3:15 PM, Chris Fields >>> wrote: >>> >>> I asked Lincoln about this but hadn't received a reply; oddly, I >>> removed >>>> scripts/biographics and examples/biographics from trunk but the >>>> merge >>>> didn't >>>> remove them from the branch. They won't be in RC2 (Sun-Mon). >>>> >>>> chris >>>> >>>> >>>> On Dec 30, 2008, at 12:48 PM, Scott Cain wrote: >>>> >>>> Hi, >>>> >>>>> >>>>> For the scripts currently in BioPerl core that use BioGraphics, >>>>> do we >>>>> think that they should no longer be distributed with BioPerl but >>>>> should instead be moved to the BioGraphics distribution? I >>>>> imagine >>>>> someone trying to use bp_embl2picture.pl and being surprised >>>>> that it >>>>> doesn't work. >>>>> >>>>> Thoughts? >>>>> >>>>> Scott >>>>> >>>>> >>>>> On Tue, Dec 30, 2008 at 11:16 AM, Christopher Fields >>>>> wrote: >>>>> >>>>> All, >>>>>> >>>>>> I can't respond adequately until I return from vacation; I'm >>>>>> responding >>>>>> from a dial-up line in Texas (?!?) so responding to each >>>>>> message in >>>>>> kind >>>>>> will take a year or two (I did mention that I would be away >>>>>> from Dec >>>>>> 26-31, >>>>>> but it looks like that will be until Jan 1). >>>>>> >>>>>> >>>>>> ---- Original message ---- >>>>>> >>>>>> Date: Tue, 30 Dec 2008 02:31:43 +0000 >>>>>>> From: Sendu Bala >>>>>>> Subject: Re: [Bioperl-l] BioPerl 1.6 RC1 >>>>>>> To: Alex Lancaster >>>>>>> Cc: bioperl-l at lists.open-bio.org, Chris Fields >>>>>>> >>>>>>> >>>>>>> >>>>>>> Alex Lancaster wrote: >>>>>>> >>>>>>> "SB" == Sendu Bala writes: >>>>>>>> >>>>>>>>> >>>>>>>>>>>>>>> Also can you clarify the expected name of the >>>>>>>>>>>>>>> tarball, is it >>>>>>>>>>>>>> >>>>>>>>>>>>> bioperl, >>>>>>>> or BioPerl? The 1.5.2 release used >>>>>>>> bioperl-1.5.2_102.tar.bz2 whereas >>>>>>>> 1.5.9._1 uses BioPerl-1.5.9._1.tar.bz2 and it would be good >>>>>>>> if there >>>>>>>> was consistency as it really helps from maintaining the >>>>>>>> packages and >>>>>>>> generating links etc. >>>>>>>> >>>>>>>> >>>>>>> Naming consistency is built into the system. >>>>>>> ./Build dist >>>>>>> generates a file named: >>>>>>> bioperl-1.5.9_1.tar.bz2 >>>>>>> >>>>>>> I guess Chris decided to rename the file before uploading, >>>>>>> and its up >>>>>>> to >>>>>>> him what future files are named, but I second your suggestion >>>>>>> this >>>>>>> should be consistent. >>>>>>> >>>>>>> >>>>>> The package is named after the toolkit (BioPerl vs bioperl). >>>>>> We can >>>>>> revert back to simply 'bioperl', but since we keep referring >>>>>> to the >>>>>> package >>>>>> as 'BioPerl' on the wiki and elsewhere we should use that for >>>>>> the CPAN >>>>>> from >>>>>> this point on. >>>>>> >>>>>> Chris: I note that extraneous files like 'test.txt' and others >>>>>> made it >>>>>> >>>>>>> into the RC1 .tar.gz you uploaded. What I always did was a clean >>>>>>> export >>>>>>> of the tag and built from there. BTW, the dist action also >>>>>>> warns you >>>>>>> about modules with their own version: >>>>>>> Bio::DB::GFF::Aggregator::orf in >>>>>>> this case. You might want to investigate that. >>>>>>> >>>>>>> >>>>>> I noticed that it's packaging up everything in the local >>>>>> directory, yes >>>>>> (that was after the upload unfortunately). That'll be fixed >>>>>> for RC2; >>>>>> I'll >>>>>> look for a more amenable fix when I get back (a packlist of >>>>>> files would >>>>>> work >>>>>> around this, but I'm not sure how well that will work with a >>>>>> large >>>>>> distro >>>>>> like BioPerl). >>>>>> >>>>>> SB> There would most likely be a single CPAN bundle specifying >>>>>> all the >>>>>> >>>>>>> SB> different BioPerl packages but without any version number >>>>>>>> SB> specifications. When a user installs the bundle it would >>>>>>>> install >>>>>>>> SB> the latest version of each package. >>>>>>>> >>>>>>>> SB> Each individual sub-package, on the other hand, would >>>>>>>> specify the >>>>>>>> SB> version of any other sub-packages or core that it >>>>>>>> depends on. >>>>>>>> >>>>>>>> OK, right. So if any of the sub-packages were incremented >>>>>>>> independently, would a new bundle be generated, or would new >>>>>>>> bundles >>>>>>>> only be updated for major releases? Hmm, I'm not sure if >>>>>>>> subpackages >>>>>>>> with different version numbers from the main package can be >>>>>>>> generated >>>>>>>> from a single SRPM, so that might be a bit tricky. But if >>>>>>>> core is >>>>>>>> only a small number of CPAN pakcages, that might not be so bad, >>>>>>>> although it would mean having to go through review for each >>>>>>>> of the >>>>>>>> (new) CPAN modules and more maintainance, so it might be a >>>>>>>> while >>>>>>>> before it would be in Fedora. When is this scheduled to >>>>>>>> happen? >>>>>>>> (post-1.6, I hope!) >>>>>>>> >>>>>>>> >>>>>>> 'core' will only ever be one CPAN package (one tarball). >>>>>>> A new bundle would not be generated when a sub-package is >>>>>>> incremented. >>>>>>> The whole point of sub-packages is that they're independent >>>>>>> and can be >>>>>>> developed and released without affecting core or the other >>>>>>> sub-packages. >>>>>>> >>>>>>> The only reason for a bundle update would be to add more new >>>>>>> sub-packages to it. >>>>>>> >>>>>>> Again, how does Fedora currently emulate CPAN Bundles? >>>>>>> >>>>>>> >>>>>>> Just so we're not getting our wires crossed, in this context >>>>>>> 'core' >>>>>>> would be BioPerl-1.5.9._1.tar.bz2 and 6 examples of sub- >>>>>>> packages would >>>>>>> be the .tar.bz2 distribution files for Bio::Graphics, >>>>>>> Bio::ASN1::EntrezGene, BioPerl-run, BioPerl-db, BioPerl- >>>>>>> network and >>>>>>> BioPerl-ext. >>>>>>> >>>>>>> The kind of thing that could then happen in the future is >>>>>>> that (to >>>>>>> take >>>>>>> some random imaginary examples) BioPerl-1.7.0.tar.bz2 is >>>>>>> released as >>>>>>> 'core' which is a bit smaller than BioPerl-1.5.9._1.tar.bz2 >>>>>>> because >>>>>>> Bio::Structure is missing from it, and there is a new >>>>>>> independent >>>>>>> sub-package released for Bio::Structure, just like what >>>>>>> happened with >>>>>>> Bio::Graphics. >>>>>>> >>>>>>> >>>>>>> "Requires: perl(Bio::Graphics)" >>>>>>> >>>>>>>> >>>>>>>>> >>>>>>>> RPM has a script with heuristics that search .pm and .pl >>>>>>>> files for >>>>>>>> 'use ' type constructs to automatically generate >>>>>>>> 'Requires", that sometimes guess wrong. To check, I grepped an >>>>>>>> exploded package for instances of 'Bio::Graphics' and what >>>>>>>> returned >>>>>>>> is >>>>>>>> below, at the end of the e-mail. I suspect that the 'use >>>>>>>> Bio::Graphics' in some of the installed scripts in bin/ such as >>>>>>>> bp_glyphs2-demo.pl are causing the issue. Shouldn't these >>>>>>>> scripts >>>>>>>> perhaps be moved to the Bio::Graphics CPAN module (along >>>>>>>> with the >>>>>>>> scripts in examples/)? >>>>>>>> >>>>>>>> >>>>>>> Thanks for pointing that out. I'll leave it to Chris to sort >>>>>>> that >>>>>>> out... >>>>>>> >>>>>>> >>>>>> Yes, those scripts should be moved over (already have >>>>>> indicated this to >>>>>> Lincoln). I can't check my local svn co (it's sitting about >>>>>> ~1000 >>>>>> miles >>>>>> away from me in a closet right now). >>>>>> >>>>>> If the Bio::Graphics is truly not needed, for the moment it is >>>>>> >>>>>>> possible to also override and filter out the bogus Requires >>>>>>> until such >>>>>>>> time as these scripts are moved to the appropriate place. >>>>>>>> >>>>>>>> >>>>>>> Great, go ahead and do that if you like. >>>>>>> >>>>>>> >>>>>> I'm not quite sure why we are attempting to RPM package up a >>>>>> release >>>>>> candidate unless it's strictly for the purposes of testing >>>>>> things out. >>>>>> I >>>>>> anticipate the final 1.6 will be out in short period of time >>>>>> (within a >>>>>> few >>>>>> weeks). Maybe this has already been answered, just haven't >>>>>> had time to >>>>>> read >>>>>> back along the thread yet. >>>>>> >>>>>> Anyway, patience everyone. This is an RC not a final release, >>>>>> and I >>>>>> anticipated that a few things would probably be screwy. It >>>>>> appears >>>>>> only a >>>>>> few things need to be addressed and cleaned up prior to a final >>>>>> release, so >>>>>> overall RC1 did what I wanted (including uncovering an odd >>>>>> PAML bug >>>>>> according to CPAN Testers). >>>>>> >>>>>> -c (from the backwoods in Texas) >>>>>> _______________________________________________ >>>>>> Bioperl-l mailing list >>>>>> Bioperl-l at lists.open-bio.org >>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>>>> >>>>>> >>>>>> >>>>> >>>>> -- >>>>> ------------------------------------------------------------------ >>>>> ------ >>>>> Scott Cain, Ph. D. scott at >>>>> scottcain >>>>> dot net >>>>> GMOD Coordinator (http://gmod.org/) >>>>> 216-392-3087 >>>>> Ontario Institute for Cancer Research >>>>> _______________________________________________ >>>>> Bioperl-l mailing list >>>>> Bioperl-l at lists.open-bio.org >>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>>> >>>>> >>>> _______________________________________________ >>>> Bioperl-l mailing list >>>> Bioperl-l at lists.open-bio.org >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>> >>>> >>> >>> >>> -- >>> Lincoln D. Stein >>> >>> Ontario Institute for Cancer Research >>> 101 College St., Suite 800 >>> Toronto, ON, Canada M5G0A3 >>> 416 673-8514 >>> Assistant: Renata Musa >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>> >> >> > > > -- > Lincoln D. Stein > > Ontario Institute for Cancer Research > 101 College St., Suite 800 > Toronto, ON, Canada M5G0A3 > 416 673-8514 > Assistant: Renata Musa > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From abhishek.vit at gmail.com Tue Jan 6 00:42:56 2009 From: abhishek.vit at gmail.com (Abhishek Pratap) Date: Tue, 6 Jan 2009 00:42:56 -0500 Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl Message-ID: Hi All I am looking for some code to parse the ACE file format. I have big ACE files which I would like to trim based on the user defined Contig name and specific region and write out the output to another fresh ACE file. For now I am trying to tweak Bio::Assembly::IO; but it is kind of slow. Any other alternative or suggestions. Thanks All, -Abhi -- ----------------------------- Abhishek Pratap Bioinformatics Software Engineer Institute for Genome Sciences School of Medicine, Univ of Maryland 801, W. Baltimore Street, Baltimore, MD 21209 Ph: (+1)-410-706-2296 www.igs.umaryland.edu/ Chair RSG-Worldwide ISCB-Student Council http://iscbsc.org/rsg www.bioinfosolutions.com From MEC at stowers.org Tue Jan 6 09:26:07 2009 From: MEC at stowers.org (Cook, Malcolm) Date: Tue, 6 Jan 2009 08:26:07 -0600 Subject: [Bioperl-l] K-mer generating script In-Reply-To: References: <46AC2823CE864DD8BB2926D499FB22E3@NewLife> <3C518A10-A204-418B-BC7D-A5C7EDC3581E@bioperl.org> <0084EA43-1C21-49C0-9E2E-EA9FA838DE9A@illinois.edu> Message-ID: oh... and... if you need the results in a perl array, and you're running under some unix, try the even terser: #!/usr/bin/env perl my $k = shift; my @kmer = split / /, `echo @{['{A,T,G,C}' x $k]}`; --Malcolm Cook > -----Original Message----- > From: bioperl-l-bounces at lists.open-bio.org > [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of > Cook, Malcolm > Sent: Monday, January 05, 2009 1:15 PM > To: 'Chris Fields'; 'Jason Stajich' > Cc: 'bioperl list'; 'Mark A. Jensen'; Blanchette, Marco > Subject: Re: [Bioperl-l] K-mer generating script > > Gang, > > I couldn't resist adding the following non-perl solution... > > #!/bin/bash > k=$1 > s=$( printf "%${k}s" ); # a string with $k blanks > s=${s// /{A,T,G,C\}}; # substitute '{A,T,G,C}' for each of > the k blanks > echo 'kmers using bash to expand:' $s > /dev/stderr > bash -c "echo $s"; # let brace expanion of inferior bash > compute the cross product > > -- Malcolm > > > > -----Original Message----- > > From: bioperl-l-bounces at lists.open-bio.org > > [mailto:bioperl-l-bounces at lists.open-bio.org] On Behalf Of Chris > > Fields > > Sent: Friday, December 19, 2008 11:54 PM > > To: Jason Stajich > > Cc: bioperl list; Mark A. Jensen; Blanchette, Marco > > Subject: Re: [Bioperl-l] K-mer generating script > > > > To add to the pile: > > > > Mark-Jason Dominus tackles this problem in Higher-Order Perl using > > iterators, which also allows other nifty bits like 'give > variants of > > A(CTG)T(TGA)', where anything in parentheses are > wild-cards. The nice > > advantage of the iterator approach is you don't tank memory > for long > > strings. > > Furthermore, as a bonus, you can now download the book for > > free: > > > > http://hop.perl.plover.com/book/ > > > > The relevant chapter is here (p. 135): > > > > http://hop.perl.plover.com/book/pdf/04Iterators.pdf > > > > chris > > > > On Dec 19, 2008, at 11:02 PM, Jason Stajich wrote: > > > > > Does someone want to put this on the wiki too? > > > > > > Maybe we could start a little bit of perl snippets for > > examples like > > > these. > > > > > > -j > > > On Dec 19, 2008, at 7:45 PM, Mark A. Jensen wrote: > > > > > >> A little sloppy, but it recurses and is general--- > > >> > > >> # ex... > > >> @combs = doit(3, [ qw( A T G C ) ]); 1; # code > > >> > > >> sub doit { > > >> my ($n, $sym) = @_; > > >> my $a = []; > > >> doit_guts($n, $sym, $a, ''); > > >> return map {$_ || ()} @$a; > > >> } > > >> > > >> sub doit_guts { > > >> my ($n, $sym, $store, $str) = @_; > > >> if (!$n) { > > >> return $str; > > >> } > > >> else { > > >> foreach my $s (@$sym) { > > >> push @$store, doit_guts($n-1, $sym, $store, $str.$s); } } } > > >> > > >> > > >> ----- Original Message ----- From: "Blanchette, Marco" > > >> > >> > > > >> To: > > >> Sent: Friday, December 19, 2008 6:25 PM > > >> Subject: [Bioperl-l] K-mer generating script > > >> > > >> > > >>> Dear all, > > >>> > > >>> Does anyone have a little function that I could use to > > generate all > > >>> possible k-mer DNA sequences? For instance all possible > > 3-mer (AAA, > > >>> AAT, AAC, AAG, etc...). I need something that I could input the > > >>> value of k and get all possible sequences... > > >>> > > >>> I know that it's a problem that need to use recursive > programming > > >>> but I can't get my brain around the problem. > > >>> > > >>> Many thanks > > >>> > > >>> Marco > > >>> -- > > >>> Marco Blanchette, Ph.D. > > >>> Assistant Investigator > > >>> Stowers Institute for Medical Research 1000 East 50th St. > > >>> > > >>> Kansas City, MO 64110 > > >>> > > >>> Tel: 816-926-4071 > > >>> Cell: 816-726-8419 > > >>> Fax: 816-926-2018 > > >>> > > >>> _______________________________________________ > > >>> Bioperl-l mailing list > > >>> Bioperl-l at lists.open-bio.org > > >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l > > >>> > > >> > > >> _______________________________________________ > > >> Bioperl-l mailing list > > >> Bioperl-l at lists.open-bio.org > > >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > > > > > > Jason Stajich > > > jason at bioperl.org > > > > > > > > > > > > _______________________________________________ > > > Bioperl-l mailing list > > > Bioperl-l at lists.open-bio.org > > > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > From akarger at CGR.Harvard.edu Tue Jan 6 11:00:40 2009 From: akarger at CGR.Harvard.edu (Amir Karger) Date: Tue, 6 Jan 2009 11:00:40 -0500 Subject: [Bioperl-l] environment variables (et al.) for bioperl-run tests Message-ID: <72AF30DC2881964CB911FD08E57157E7027BCB73@lsdiv-msxbe-001.nucleus.harvard.edu> We just installed Bioperl-run on a cluster with very limited environment variables. So a huge number of tests failed. I would *really* appreciate it if the wiki had info on which environment variables need to be set for all the Bioperl::Run::* packages so that ./Build test will work. Since it would be a pretty big job for any one person, perhaps somebody can make a page (or an area of http://www.bioperl.org/wiki/Installing_Bioperl_for_Unix or maybe http://www.bioperl.org/wiki/Run_package with links back & forth) with spaces for all the modules, and each module's maintainer can put in their one or two environment variables? It would make my life and the life of many others a lot easier than having to read every package's documentation. Thanks in advance, -Amir Karger Life Sciences Research Computing, FAS IT Harvard University From cjfields at illinois.edu Tue Jan 6 11:58:40 2009 From: cjfields at illinois.edu (Chris Fields) Date: Tue, 6 Jan 2009 10:58:40 -0600 Subject: [Bioperl-l] environment variables (et al.) for bioperl-run tests In-Reply-To: <72AF30DC2881964CB911FD08E57157E7027BCB73@lsdiv-msxbe-001.nucleus.harvard.edu> References: <72AF30DC2881964CB911FD08E57157E7027BCB73@lsdiv-msxbe-001.nucleus.harvard.edu> Message-ID: This is on the agenda for the BioPerl-run 1.6 release. We have a bug tracking this: http://bugzilla.open-bio.org/show_bug.cgi?id=2514 Feel free to add your own test results to this as an attachment; I'll probably start working on that this week. chris On Jan 6, 2009, at 10:00 AM, Amir Karger wrote: > We just installed Bioperl-run on a cluster with very limited > environment > variables. So a huge number of tests failed. > > I would *really* appreciate it if the wiki had info on which > environment > variables need to be set for all the Bioperl::Run::* packages so that > ./Build test will work. Since it would be a pretty big job for any one > person, perhaps somebody can make a page (or an area of > http://www.bioperl.org/wiki/Installing_Bioperl_for_Unix or maybe > http://www.bioperl.org/wiki/Run_package with links back & forth) with > spaces for all the modules, and each module's maintainer can put in > their one or two environment variables? It would make my life and the > life of many others a lot easier than having to read every package's > documentation. > > Thanks in advance, > > -Amir Karger > Life Sciences Research Computing, FAS IT > Harvard University > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From bix at sendu.me.uk Tue Jan 6 12:13:46 2009 From: bix at sendu.me.uk (Sendu Bala) Date: Tue, 06 Jan 2009 17:13:46 +0000 Subject: [Bioperl-l] environment variables (et al.) for bioperl-run tests In-Reply-To: <72AF30DC2881964CB911FD08E57157E7027BCB73@lsdiv-msxbe-001.nucleus.harvard.edu> References: <72AF30DC2881964CB911FD08E57157E7027BCB73@lsdiv-msxbe-001.nucleus.harvard.edu> Message-ID: <4963914A.1020108@sendu.me.uk> Amir Karger wrote: > We just installed Bioperl-run on a cluster with very limited environment > variables. So a huge number of tests failed. None of the tests should fail. It's a bug if they do, so please let us know the details. When an environment variable isn't set or a program not installed, the test should skip, not fail. From akarger at CGR.Harvard.edu Tue Jan 6 12:44:32 2009 From: akarger at CGR.Harvard.edu (Amir Karger) Date: Tue, 6 Jan 2009 12:44:32 -0500 Subject: [Bioperl-l] environment variables (et al.) for bioperl-run tests References: <72AF30DC2881964CB911FD08E57157E7027BCB73@lsdiv-msxbe-001.nucleus.harvard.edu> <4963914A.1020108@sendu.me.uk> Message-ID: <72AF30DC2881964CB911FD08E57157E7027BCBAE@lsdiv-msxbe-001.nucleus.harvard.edu> > Amir Karger wrote: > > We just installed Bioperl-run on a cluster with very limited > environment > > variables. So a huge number of tests failed. > > None of the tests should fail. It's a bug if they do, so please let > us > know the details. When an environment variable isn't set or a > program > not installed, the test should skip, not fail. Oops! I lied. I should have more clearly stated that most of the tests nicely skipped, and some even told me that a certain environment variable should be set. The only things that actually broke are: t/AnalysisFactory_soap....10/12 proxy: transport protocol not specified # Looks like you planned 12 tests but only ran 11. # Looks like your test died just after 11. t/AnalysisFactory_soap.... Dubious, test returned 255 (wstat 65280, 0xff00) Failed 1/12 subtests Also, I got an error from RepeatMasker and Vista, which should probably be more graceful when things aren't in the PATH: t/RepeatMasker............Use of uninitialized value in concatenation (.) or string at /odyssey/apps/src/bioperl-run-1.5.2_100/blib/lib/Bio/Tools/Run/RepeatMas ker.pm line 175. RepeatMasker program not found as or not executable. RepeatMasker program not found. Skipping tests 1 to 10. t/Vista...................readline() on closed filehandle PIPE at t/Vista.t line 39. Use of uninitialized value in numeric lt (<) at t/Vista.t line 53. You need at least version 1.2 of JDK to run vista It looks like the bug Chris referred me to is a bug to fix the above errors, which is great. But if all the tests pass and I haven't actually tested any of my bio binaries, I'm going to be kind of bummed when I actually try to use them. I'm not sure how flexible the testing mechanism is: is there an easy way to give the user a one-line feedback when they run the test that says "The following binaries weren't found or did not have relevant environment variables set, so their subtests were skipped: blastall, clustalw, primer3, ...". That would be awesome. Even better would be if it referenced a file to look at or a wiki page listing how to set up PATH and other environment variables for each binary. Sorry for the mis-type. -Amir From cjfields at illinois.edu Tue Jan 6 14:22:18 2009 From: cjfields at illinois.edu (Chris Fields) Date: Tue, 6 Jan 2009 13:22:18 -0600 Subject: [Bioperl-l] environment variables (et al.) for bioperl-run tests In-Reply-To: <72AF30DC2881964CB911FD08E57157E7027BCBAE@lsdiv-msxbe-001.nucleus.harvard.edu> References: <72AF30DC2881964CB911FD08E57157E7027BCB73@lsdiv-msxbe-001.nucleus.harvard.edu> <4963914A.1020108@sendu.me.uk> <72AF30DC2881964CB911FD08E57157E7027BCBAE@lsdiv-msxbe-001.nucleus.harvard.edu> Message-ID: <9F2DBCE4-2EA1-435E-B2D0-DFBFDD3ECBC6@illinois.edu> On Jan 6, 2009, at 11:44 AM, Amir Karger wrote: >> Amir Karger wrote: >>> We just installed Bioperl-run on a cluster with very limited >> environment >>> variables. So a huge number of tests failed. >> >> None of the tests should fail. It's a bug if they do, so please let >> us >> know the details. When an environment variable isn't set or a >> program >> not installed, the test should skip, not fail. > > Oops! I lied. I should have more clearly stated that most of the tests > nicely skipped, and some even told me that a certain environment > variable should be set. The only things that actually broke are: > > t/AnalysisFactory_soap....10/12 proxy: transport protocol not > specified > # Looks like you planned 12 tests but only ran 11. > # Looks like your test died just after 11. > t/AnalysisFactory_soap.... Dubious, test returned 255 (wstat 65280, > 0xff00) > Failed 1/12 subtests > > Also, I got an error from RepeatMasker and Vista, which should > probably > be more graceful when things aren't in the PATH: > > t/RepeatMasker............Use of uninitialized value in concatenation > (.) or string at > /odyssey/apps/src/bioperl-run-1.5.2_100/blib/lib/Bio/Tools/Run/ > RepeatMas > ker.pm line 175. > RepeatMasker program not found as or not executable. > RepeatMasker program not found. Skipping tests 1 to 10. > > t/Vista...................readline() on closed filehandle PIPE at > t/Vista.t line 39. > Use of uninitialized value in numeric lt (<) at t/Vista.t line 53. > You need at least version 1.2 of JDK to run vista > > It looks like the bug Chris referred me to is a bug to fix the above > errors, which is great. But if all the tests pass and I haven't > actually > tested any of my bio binaries, I'm going to be kind of bummed when I > actually try to use them. I'm not sure how flexible the testing > mechanism is: is there an easy way to give the user a one-line > feedback > when they run the test that says "The following binaries weren't found > or did not have relevant environment variables set, so their subtests > were skipped: blastall, clustalw, primer3, ...". That would be > awesome. > Even better would be if it referenced a file to look at or a wiki page > listing how to set up PATH and other environment variables for each > binary. > > Sorry for the mis-type. > > -Amir I'll look into the test fails if I can reproduce them (they'll be archived with the bug report), and add that last bit as an enhancement request to bugzilla. chris From Russell.Smithies at agresearch.co.nz Tue Jan 6 15:36:27 2009 From: Russell.Smithies at agresearch.co.nz (Smithies, Russell) Date: Wed, 7 Jan 2009 09:36:27 +1300 Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl In-Reply-To: References: Message-ID: <18DF7D20DFEC044098A1062202F5FFF31A69523F20@exchsth.agresearch.co.nz> Here's how I've been doing it: my $infile = "454Contigs.ace"; my $parser = new Bio::Assembly::IO(-file => $infile ,-format => "ace") or die $!; my $assembly = $parser->next_assembly; # to work with a named contig my @wanted_id = ("Contig100"); my ($contig) = $assembly->select_contigs(@wanted_id) or die $!; #get the consensus my $consensus = $contig->get_consensus_sequence(); #get the consensus qualities my @quality_values = @{$contig->get_consensus_quality()->qual()}; hope this helps, Russell > -----Original Message----- > From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l- > bounces at lists.open-bio.org] On Behalf Of Abhishek Pratap > Sent: Tuesday, 6 January 2009 6:43 p.m. > To: bioperl-l at lists.open-bio.org > Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl > > Hi All > > I am looking for some code to parse the ACE file format. I have big ACE > files which I would like to trim based on the user defined Contig name > and > specific region and write out the output to another fresh ACE file. > > For now I am trying to tweak Bio::Assembly::IO; but it is kind of slow. > Any > other alternative or suggestions. > > Thanks All, > -Abhi > > > > > > > > > -- > ----------------------------- > Abhishek Pratap > Bioinformatics Software Engineer > Institute for Genome Sciences > School of Medicine, Univ of Maryland > 801, W. Baltimore Street, Baltimore, MD 21209 > Ph: (+1)-410-706-2296 > www.igs.umaryland.edu/ > > Chair > RSG-Worldwide > ISCB-Student Council > http://iscbsc.org/rsg > > www.bioinfosolutions.com > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l ======================================================================= Attention: The information contained in this message and/or attachments from AgResearch Limited is intended only for the persons or entities to which it is addressed and may contain confidential and/or privileged material. Any review, retransmission, dissemination or other use of, or taking of any action in reliance upon, this information by persons or entities other than the intended recipients is prohibited by AgResearch Limited. If you have received this message in error, please notify the sender immediately. ======================================================================= From abhishek.vit at gmail.com Tue Jan 6 15:43:31 2009 From: abhishek.vit at gmail.com (Abhishek Pratap) Date: Tue, 6 Jan 2009 15:43:31 -0500 Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl In-Reply-To: <18DF7D20DFEC044098A1062202F5FFF31A69523F20@exchsth.agresearch.co.nz> References: <18DF7D20DFEC044098A1062202F5FFF31A69523F20@exchsth.agresearch.co.nz> Message-ID: Thanks that helped. Any method to write Ace files ? Thanks, -Abhi On Tue, Jan 6, 2009 at 3:36 PM, Smithies, Russell < Russell.Smithies at agresearch.co.nz> wrote: > Here's how I've been doing it: > > > my $infile = "454Contigs.ace"; > my $parser = new Bio::Assembly::IO(-file => $infile ,-format => "ace") or > die $!; > my $assembly = $parser->next_assembly; > > # to work with a named contig > my @wanted_id = ("Contig100"); > my ($contig) = $assembly->select_contigs(@wanted_id) or die $!; > > #get the consensus > my $consensus = $contig->get_consensus_sequence(); > > #get the consensus qualities > my @quality_values = @{$contig->get_consensus_quality()->qual()}; > > hope this helps, > > Russell > > > > -----Original Message----- > > From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l- > > bounces at lists.open-bio.org] On Behalf Of Abhishek Pratap > > Sent: Tuesday, 6 January 2009 6:43 p.m. > > To: bioperl-l at lists.open-bio.org > > Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl > > > > Hi All > > > > I am looking for some code to parse the ACE file format. I have big ACE > > files which I would like to trim based on the user defined Contig name > > and > > specific region and write out the output to another fresh ACE file. > > > > For now I am trying to tweak Bio::Assembly::IO; but it is kind of slow. > > Any > > other alternative or suggestions. > > > > Thanks All, > > -Abhi > > > > > > > > > > > > > > > > > > -- > > ----------------------------- > > Abhishek Pratap > > Bioinformatics Software Engineer > > Institute for Genome Sciences > > School of Medicine, Univ of Maryland > > 801, W. Baltimore Street, Baltimore, MD 21209 > > Ph: (+1)-410-706-2296 > > www.igs.umaryland.edu/ > > > > Chair > > RSG-Worldwide > > ISCB-Student Council > > http://iscbsc.org/rsg > > > > www.bioinfosolutions.com > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/bioperl-l > ======================================================================= > Attention: The information contained in this message and/or attachments > from AgResearch Limited is intended only for the persons or entities > to which it is addressed and may contain confidential and/or privileged > material. Any review, retransmission, dissemination or other use of, or > taking of any action in reliance upon, this information by persons or > entities other than the intended recipients is prohibited by AgResearch > Limited. If you have received this message in error, please notify the > sender immediately. > ======================================================================= > -- ----------------------------- Abhishek Pratap Bioinformatics Software Engineer Institute for Genome Sciences School of Medicine, Univ of Maryland 801, W. Baltimore Street, Baltimore, MD 21209 Ph: (+1)-410-706-2296 www.igs.umaryland.edu/ Chair RSG-Worldwide ISCB-Student Council http://iscbsc.org/rsg www.bioinfosolutions.com From cjfields at illinois.edu Tue Jan 6 15:52:48 2009 From: cjfields at illinois.edu (Chris Fields) Date: Tue, 6 Jan 2009 14:52:48 -0600 Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl In-Reply-To: References: <18DF7D20DFEC044098A1062202F5FFF31A69523F20@exchsth.agresearch.co.nz> Message-ID: Not at this time (write_assembly is not implemented). If you come up with code to do so let us know (patches are always welcome). chris On Jan 6, 2009, at 2:43 PM, Abhishek Pratap wrote: > Thanks that helped. > > Any method to write Ace files ? > > Thanks, > -Abhi > > On Tue, Jan 6, 2009 at 3:36 PM, Smithies, Russell < > Russell.Smithies at agresearch.co.nz> wrote: > >> Here's how I've been doing it: >> >> >> my $infile = "454Contigs.ace"; >> my $parser = new Bio::Assembly::IO(-file => $infile ,-format => >> "ace") or >> die $!; >> my $assembly = $parser->next_assembly; >> >> # to work with a named contig >> my @wanted_id = ("Contig100"); >> my ($contig) = $assembly->select_contigs(@wanted_id) or die $!; >> >> #get the consensus >> my $consensus = $contig->get_consensus_sequence(); >> >> #get the consensus qualities >> my @quality_values = @{$contig->get_consensus_quality()->qual()}; >> >> hope this helps, >> >> Russell >> >> >>> -----Original Message----- >>> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l- >>> bounces at lists.open-bio.org] On Behalf Of Abhishek Pratap >>> Sent: Tuesday, 6 January 2009 6:43 p.m. >>> To: bioperl-l at lists.open-bio.org >>> Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl >>> >>> Hi All >>> >>> I am looking for some code to parse the ACE file format. I have >>> big ACE >>> files which I would like to trim based on the user defined Contig >>> name >>> and >>> specific region and write out the output to another fresh ACE file. >>> >>> For now I am trying to tweak Bio::Assembly::IO; but it is kind of >>> slow. >>> Any >>> other alternative or suggestions. >>> >>> Thanks All, >>> -Abhi >>> >>> >>> >>> >>> >>> >>> >>> >>> -- >>> ----------------------------- >>> Abhishek Pratap >>> Bioinformatics Software Engineer >>> Institute for Genome Sciences >>> School of Medicine, Univ of Maryland >>> 801, W. Baltimore Street, Baltimore, MD 21209 >>> Ph: (+1)-410-706-2296 >>> www.igs.umaryland.edu/ >>> >>> Chair >>> RSG-Worldwide >>> ISCB-Student Council >>> http://iscbsc.org/rsg >>> >>> www.bioinfosolutions.com >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> = >> = >> ===================================================================== >> Attention: The information contained in this message and/or >> attachments >> from AgResearch Limited is intended only for the persons or entities >> to which it is addressed and may contain confidential and/or >> privileged >> material. Any review, retransmission, dissemination or other use >> of, or >> taking of any action in reliance upon, this information by persons or >> entities other than the intended recipients is prohibited by >> AgResearch >> Limited. If you have received this message in error, please notify >> the >> sender immediately. >> = >> = >> ===================================================================== >> > > > > -- > ----------------------------- > Abhishek Pratap > Bioinformatics Software Engineer > Institute for Genome Sciences > School of Medicine, Univ of Maryland > 801, W. Baltimore Street, Baltimore, MD 21209 > Ph: (+1)-410-706-2296 > www.igs.umaryland.edu/ > > Chair > RSG-Worldwide > ISCB-Student Council > http://iscbsc.org/rsg > > www.bioinfosolutions.com > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From abhishek.vit at gmail.com Tue Jan 6 16:07:12 2009 From: abhishek.vit at gmail.com (Abhishek Pratap) Date: Tue, 6 Jan 2009 16:07:12 -0500 Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl In-Reply-To: References: <18DF7D20DFEC044098A1062202F5FFF31A69523F20@exchsth.agresearch.co.nz> Message-ID: Ok .. Sure in case we do write something which eventually I will have to :) I will fwd it. @Russel: I feel to get info for specific the current method is very slow as it tries to store the info for all contigs into memory. Such info could be memory intensive specially with the next gen data coming from 454 sequencers. I think we should grep to the contig/s of itnerest and then create a record for it. Please correct me if I am wrong. Thanks, -Abhi On Tue, Jan 6, 2009 at 3:52 PM, Chris Fields wrote: > Not at this time (write_assembly is not implemented). If you come up with > code to do so let us know (patches are always welcome). > > chris > > > On Jan 6, 2009, at 2:43 PM, Abhishek Pratap wrote: > > Thanks that helped. >> >> Any method to write Ace files ? >> >> Thanks, >> -Abhi >> >> On Tue, Jan 6, 2009 at 3:36 PM, Smithies, Russell < >> Russell.Smithies at agresearch.co.nz> wrote: >> >> Here's how I've been doing it: >>> >>> >>> my $infile = "454Contigs.ace"; >>> my $parser = new Bio::Assembly::IO(-file => $infile ,-format => "ace") >>> or >>> die $!; >>> my $assembly = $parser->next_assembly; >>> >>> # to work with a named contig >>> my @wanted_id = ("Contig100"); >>> my ($contig) = $assembly->select_contigs(@wanted_id) or die $!; >>> >>> #get the consensus >>> my $consensus = $contig->get_consensus_sequence(); >>> >>> #get the consensus qualities >>> my @quality_values = @{$contig->get_consensus_quality()->qual()}; >>> >>> hope this helps, >>> >>> Russell >>> >>> >>> -----Original Message----- >>>> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l- >>>> bounces at lists.open-bio.org] On Behalf Of Abhishek Pratap >>>> Sent: Tuesday, 6 January 2009 6:43 p.m. >>>> To: bioperl-l at lists.open-bio.org >>>> Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl >>>> >>>> Hi All >>>> >>>> I am looking for some code to parse the ACE file format. I have big ACE >>>> files which I would like to trim based on the user defined Contig name >>>> and >>>> specific region and write out the output to another fresh ACE file. >>>> >>>> For now I am trying to tweak Bio::Assembly::IO; but it is kind of slow. >>>> Any >>>> other alternative or suggestions. >>>> >>>> Thanks All, >>>> -Abhi >>>> >>>> >>>> >>>> >>>> >>>> >>>> >>>> >>>> -- >>>> ----------------------------- >>>> Abhishek Pratap >>>> Bioinformatics Software Engineer >>>> Institute for Genome Sciences >>>> School of Medicine, Univ of Maryland >>>> 801, W. Baltimore Street, Baltimore, MD 21209 >>>> Ph: (+1)-410-706-2296 >>>> www.igs.umaryland.edu/ >>>> >>>> Chair >>>> RSG-Worldwide >>>> ISCB-Student Council >>>> http://iscbsc.org/rsg >>>> >>>> www.bioinfosolutions.com >>>> _______________________________________________ >>>> Bioperl-l mailing list >>>> Bioperl-l at lists.open-bio.org >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>> >>> ======================================================================= >>> Attention: The information contained in this message and/or attachments >>> from AgResearch Limited is intended only for the persons or entities >>> to which it is addressed and may contain confidential and/or privileged >>> material. Any review, retransmission, dissemination or other use of, or >>> taking of any action in reliance upon, this information by persons or >>> entities other than the intended recipients is prohibited by AgResearch >>> Limited. If you have received this message in error, please notify the >>> sender immediately. >>> ======================================================================= >>> >>> >> >> >> -- >> ----------------------------- >> Abhishek Pratap >> Bioinformatics Software Engineer >> Institute for Genome Sciences >> School of Medicine, Univ of Maryland >> 801, W. Baltimore Street, Baltimore, MD 21209 >> Ph: (+1)-410-706-2296 >> www.igs.umaryland.edu/ >> >> Chair >> RSG-Worldwide >> ISCB-Student Council >> http://iscbsc.org/rsg >> >> www.bioinfosolutions.com >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > > -- ----------------------------- Abhishek Pratap Bioinformatics Software Engineer Institute for Genome Sciences School of Medicine, Univ of Maryland 801, W. Baltimore Street, Baltimore, MD 21209 Ph: (+1)-410-706-2296 www.igs.umaryland.edu/ Chair RSG-Worldwide ISCB-Student Council http://iscbsc.org/rsg www.bioinfosolutions.com From Russell.Smithies at agresearch.co.nz Tue Jan 6 16:31:50 2009 From: Russell.Smithies at agresearch.co.nz (Smithies, Russell) Date: Wed, 7 Jan 2009 10:31:50 +1300 Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl In-Reply-To: References: <18DF7D20DFEC044098A1062202F5FFF31A69523F20@exchsth.agresearch.co.nz> Message-ID: <18DF7D20DFEC044098A1062202F5FFF31A69523F2D@exchsth.agresearch.co.nz> I agree with the need for a faster parser. Although the current version does a great job, it is slow and memory intensive as it loads everything into Bio::Assembly::Scaffold objects composed of Bio::Assembly::Contig objects. I'm not sure exactly what the best solution would be, perhaps a new constructor with a named contig would simplify things? $io = new Bio::Assembly::IO(-file=>"454_assy.ace",-format=>"ace"); $contig = $io->next_assembly_with_contig(-contig=>"Contig000100")->select_contig; Or do we even need a next_assembly method? Can there be more than one assembly in an .ace file? --Russell From: Abhishek Pratap [mailto:abhishek.vit at gmail.com] Sent: Wednesday, 7 January 2009 10:07 a.m. To: Chris Fields Cc: Smithies, Russell; bioperl-l at lists.open-bio.org Subject: Re: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl Ok .. Sure in case we do write something which eventually I will have to :) I will fwd it. @Russel: I feel to get info for specific the current method is very slow as it tries to store the info for all contigs into memory. Such info could be memory intensive specially with the next gen data coming from 454 sequencers. I think we should grep to the contig/s of itnerest and then create a record for it. Please correct me if I am wrong. Thanks, -Abhi On Tue, Jan 6, 2009 at 3:52 PM, Chris Fields > wrote: Not at this time (write_assembly is not implemented). If you come up with code to do so let us know (patches are always welcome). chris On Jan 6, 2009, at 2:43 PM, Abhishek Pratap wrote: Thanks that helped. Any method to write Ace files ? Thanks, -Abhi On Tue, Jan 6, 2009 at 3:36 PM, Smithies, Russell < Russell.Smithies at agresearch.co.nz> wrote: Here's how I've been doing it: my $infile = "454Contigs.ace"; my $parser = new Bio::Assembly::IO(-file => $infile ,-format => "ace") or die $!; my $assembly = $parser->next_assembly; # to work with a named contig my @wanted_id = ("Contig100"); my ($contig) = $assembly->select_contigs(@wanted_id) or die $!; #get the consensus my $consensus = $contig->get_consensus_sequence(); #get the consensus qualities my @quality_values = @{$contig->get_consensus_quality()->qual()}; hope this helps, Russell -----Original Message----- From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l- bounces at lists.open-bio.org] On Behalf Of Abhishek Pratap Sent: Tuesday, 6 January 2009 6:43 p.m. To: bioperl-l at lists.open-bio.org Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl Hi All I am looking for some code to parse the ACE file format. I have big ACE files which I would like to trim based on the user defined Contig name and specific region and write out the output to another fresh ACE file. For now I am trying to tweak Bio::Assembly::IO; but it is kind of slow. Any other alternative or suggestions. Thanks All, -Abhi -- ----------------------------- Abhishek Pratap Bioinformatics Software Engineer Institute for Genome Sciences School of Medicine, Univ of Maryland 801, W. Baltimore Street, Baltimore, MD 21209 Ph: (+1)-410-706-2296 www.igs.umaryland.edu/ Chair RSG-Worldwide ISCB-Student Council http://iscbsc.org/rsg www.bioinfosolutions.com _______________________________________________ Bioperl-l mailing list Bioperl-l at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/bioperl-l ======================================================================= Attention: The information contained in this message and/or attachments from AgResearch Limited is intended only for the persons or entities to which it is addressed and may contain confidential and/or privileged material. Any review, retransmission, dissemination or other use of, or taking of any action in reliance upon, this information by persons or entities other than the intended recipients is prohibited by AgResearch Limited. If you have received this message in error, please notify the sender immediately. ======================================================================= -- ----------------------------- Abhishek Pratap Bioinformatics Software Engineer Institute for Genome Sciences School of Medicine, Univ of Maryland 801, W. Baltimore Street, Baltimore, MD 21209 Ph: (+1)-410-706-2296 www.igs.umaryland.edu/ Chair RSG-Worldwide ISCB-Student Council http://iscbsc.org/rsg www.bioinfosolutions.com _______________________________________________ Bioperl-l mailing list Bioperl-l at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/bioperl-l -- ----------------------------- Abhishek Pratap Bioinformatics Software Engineer Institute for Genome Sciences School of Medicine, Univ of Maryland 801, W. Baltimore Street, Baltimore, MD 21209 Ph: (+1)-410-706-2296 www.igs.umaryland.edu/ Chair RSG-Worldwide ISCB-Student Council http://iscbsc.org/rsg www.bioinfosolutions.com ======================================================================= Attention: The information contained in this message and/or attachments from AgResearch Limited is intended only for the persons or entities to which it is addressed and may contain confidential and/or privileged material. Any review, retransmission, dissemination or other use of, or taking of any action in reliance upon, this information by persons or entities other than the intended recipients is prohibited by AgResearch Limited. If you have received this message in error, please notify the sender immediately. ======================================================================= From cjfields at illinois.edu Tue Jan 6 16:34:11 2009 From: cjfields at illinois.edu (Chris Fields) Date: Tue, 6 Jan 2009 15:34:11 -0600 Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl In-Reply-To: References: <18DF7D20DFEC044098A1062202F5FFF31A69523F20@exchsth.agresearch.co.nz> Message-ID: <1B2F7003-01E5-4582-97E1-739BB5D2CD91@illinois.edu> Just a note: One of the major problems with the current Bio::Assembly implementation is all sequence features are stored in multiple Bio::SeqFeature::Collection instances (one per contig IIRC) and so one can easily tank the ulimit for opened file handles. This bods ill for 454/Solexa. Switching to a single Bio::SeqFeature::CollectionI (per contig) and storing based on both unique seq and feature IDs would probably help tremendously, particularly if the database is something like Bio::DB::SeqFeature::Store (which stores the sequence data as well). It's an open project for someone to work on if they are interested, though Florent Angly may be tackling this. chris On Jan 6, 2009, at 3:07 PM, Abhishek Pratap wrote: > Ok .. Sure in case we do write something which eventually I will > have to :) > I will fwd it. > > @Russel: > > I feel to get info for specific the current method is very slow as > it tries > to store the info for all contigs into memory. Such info could be > memory > intensive specially with the next gen data coming from 454 > sequencers. I > think we should grep to the contig/s of itnerest and then create a > record > for it. Please correct me if I am wrong. > > Thanks, > -Abhi > > On Tue, Jan 6, 2009 at 3:52 PM, Chris Fields > wrote: > >> Not at this time (write_assembly is not implemented). If you come >> up with >> code to do so let us know (patches are always welcome). >> >> chris >> >> >> On Jan 6, 2009, at 2:43 PM, Abhishek Pratap wrote: >> >> Thanks that helped. >>> >>> Any method to write Ace files ? >>> >>> Thanks, >>> -Abhi >>> >>> On Tue, Jan 6, 2009 at 3:36 PM, Smithies, Russell < >>> Russell.Smithies at agresearch.co.nz> wrote: >>> >>> Here's how I've been doing it: >>>> >>>> >>>> my $infile = "454Contigs.ace"; >>>> my $parser = new Bio::Assembly::IO(-file => $infile ,-format => >>>> "ace") >>>> or >>>> die $!; >>>> my $assembly = $parser->next_assembly; >>>> >>>> # to work with a named contig >>>> my @wanted_id = ("Contig100"); >>>> my ($contig) = $assembly->select_contigs(@wanted_id) or die $!; >>>> >>>> #get the consensus >>>> my $consensus = $contig->get_consensus_sequence(); >>>> >>>> #get the consensus qualities >>>> my @quality_values = @{$contig->get_consensus_quality()->qual()}; >>>> >>>> hope this helps, >>>> >>>> Russell >>>> >>>> >>>> -----Original Message----- >>>>> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l- >>>>> bounces at lists.open-bio.org] On Behalf Of Abhishek Pratap >>>>> Sent: Tuesday, 6 January 2009 6:43 p.m. >>>>> To: bioperl-l at lists.open-bio.org >>>>> Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in >>>>> Bioperl >>>>> >>>>> Hi All >>>>> >>>>> I am looking for some code to parse the ACE file format. I have >>>>> big ACE >>>>> files which I would like to trim based on the user defined >>>>> Contig name >>>>> and >>>>> specific region and write out the output to another fresh ACE >>>>> file. >>>>> >>>>> For now I am trying to tweak Bio::Assembly::IO; but it is kind >>>>> of slow. >>>>> Any >>>>> other alternative or suggestions. >>>>> >>>>> Thanks All, >>>>> -Abhi >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> -- >>>>> ----------------------------- >>>>> Abhishek Pratap >>>>> Bioinformatics Software Engineer >>>>> Institute for Genome Sciences >>>>> School of Medicine, Univ of Maryland >>>>> 801, W. Baltimore Street, Baltimore, MD 21209 >>>>> Ph: (+1)-410-706-2296 >>>>> www.igs.umaryland.edu/ >>>>> >>>>> Chair >>>>> RSG-Worldwide >>>>> ISCB-Student Council >>>>> http://iscbsc.org/rsg >>>>> >>>>> www.bioinfosolutions.com >>>>> _______________________________________________ >>>>> Bioperl-l mailing list >>>>> Bioperl-l at lists.open-bio.org >>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>>> >>>> = >>>> = >>>> = >>>> = >>>> =================================================================== >>>> Attention: The information contained in this message and/or >>>> attachments >>>> from AgResearch Limited is intended only for the persons or >>>> entities >>>> to which it is addressed and may contain confidential and/or >>>> privileged >>>> material. Any review, retransmission, dissemination or other use >>>> of, or >>>> taking of any action in reliance upon, this information by >>>> persons or >>>> entities other than the intended recipients is prohibited by >>>> AgResearch >>>> Limited. If you have received this message in error, please >>>> notify the >>>> sender immediately. >>>> = >>>> = >>>> = >>>> = >>>> =================================================================== >>>> >>>> >>> >>> >>> -- >>> ----------------------------- >>> Abhishek Pratap >>> Bioinformatics Software Engineer >>> Institute for Genome Sciences >>> School of Medicine, Univ of Maryland >>> 801, W. Baltimore Street, Baltimore, MD 21209 >>> Ph: (+1)-410-706-2296 >>> www.igs.umaryland.edu/ >>> >>> Chair >>> RSG-Worldwide >>> ISCB-Student Council >>> http://iscbsc.org/rsg >>> >>> www.bioinfosolutions.com >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>> >> >> > > > -- > ----------------------------- > Abhishek Pratap > Bioinformatics Software Engineer > Institute for Genome Sciences > School of Medicine, Univ of Maryland > 801, W. Baltimore Street, Baltimore, MD 21209 > Ph: (+1)-410-706-2296 > www.igs.umaryland.edu/ > > Chair > RSG-Worldwide > ISCB-Student Council > http://iscbsc.org/rsg > > www.bioinfosolutions.com > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From cjfields at illinois.edu Tue Jan 6 17:13:24 2009 From: cjfields at illinois.edu (Chris Fields) Date: Tue, 6 Jan 2009 16:13:24 -0600 Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl In-Reply-To: <18DF7D20DFEC044098A1062202F5FFF31A69523F2D@exchsth.agresearch.co.nz> References: <18DF7D20DFEC044098A1062202F5FFF31A69523F20@exchsth.agresearch.co.nz> <18DF7D20DFEC044098A1062202F5FFF31A69523F2D@exchsth.agresearch.co.nz> Message-ID: How about re-implementing Bio::Assembly classes so they simply map to Bio::DB::SeqFeature::Store (or similar) methods? Scaffold could just be a wrapper around a Bio::DB::SeqFeature::Store (which can be BDB/ mysql/postgresql/memory) and return Contigs. Similarly, the IO classes could probably act as specialized Bio::DB::SeqFeature::Store::Loade classes for the database and just return the Scaffold instance. chris On Jan 6, 2009, at 3:31 PM, Smithies, Russell wrote: > I agree with the need for a faster parser. > Although the current version does a great job, it is slow and memory > intensive as it loads everything into Bio::Assembly::Scaffold > objects composed of Bio::Assembly::Contig objects. > I'm not sure exactly what the best solution would be, perhaps a new > constructor with a named contig would simplify things? > > $io = new Bio::Assembly::IO(-file=>"454_assy.ace",-format=>"ace"); > > $contig = $io->next_assembly_with_contig(-contig=>"Contig000100")- > >select_contig; > > Or do we even need a next_assembly method? > Can there be more than one assembly in an .ace file? > > --Russell > > > > From: Abhishek Pratap [mailto:abhishek.vit at gmail.com] > Sent: Wednesday, 7 January 2009 10:07 a.m. > To: Chris Fields > Cc: Smithies, Russell; bioperl-l at lists.open-bio.org > Subject: Re: [Bioperl-l] Parser: Ace file (Sequence Assembly) in > Bioperl > > Ok .. Sure in case we do write something which eventually I will > have to :) I will fwd it. > > @Russel: > > I feel to get info for specific the current method is very slow as > it tries to store the info for all contigs into memory. Such info > could be memory intensive specially with the next gen data coming > from 454 sequencers. I think we should grep to the contig/s of > itnerest and then create a record for it. Please correct me if I am > wrong. > > Thanks, > -Abhi > On Tue, Jan 6, 2009 at 3:52 PM, Chris Fields >> wrote: > Not at this time (write_assembly is not implemented). If you come > up with code to do so let us know (patches are always welcome). > > chris > > > On Jan 6, 2009, at 2:43 PM, Abhishek Pratap wrote: > Thanks that helped. > > Any method to write Ace files ? > > Thanks, > -Abhi > > On Tue, Jan 6, 2009 at 3:36 PM, Smithies, Russell < > Russell.Smithies at agresearch.co.nz >> wrote: > Here's how I've been doing it: > > > my $infile = "454Contigs.ace"; > my $parser = new Bio::Assembly::IO(-file => $infile ,-format => > "ace") or > die $!; > my $assembly = $parser->next_assembly; > > # to work with a named contig > my @wanted_id = ("Contig100"); > my ($contig) = $assembly->select_contigs(@wanted_id) or die $!; > > #get the consensus > my $consensus = $contig->get_consensus_sequence(); > > #get the consensus qualities > my @quality_values = @{$contig->get_consensus_quality()->qual()}; > > hope this helps, > > Russell > > -----Original Message----- > From: bioperl-l-bounces at lists.open-bio.org > [mailto:bioperl-l- > bounces at lists.open-bio.org] On > Behalf Of Abhishek Pratap > Sent: Tuesday, 6 January 2009 6:43 p.m. > To: bioperl-l at lists.open-bio.org > Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl > > Hi All > > I am looking for some code to parse the ACE file format. I have big > ACE > files which I would like to trim based on the user defined Contig name > and > specific region and write out the output to another fresh ACE file. > > For now I am trying to tweak Bio::Assembly::IO; but it is kind of > slow. > Any > other alternative or suggestions. > > Thanks All, > -Abhi > > > > > > > > > -- > ----------------------------- > Abhishek Pratap > Bioinformatics Software Engineer > Institute for Genome Sciences > School of Medicine, Univ of Maryland > 801, W. Baltimore Street, Baltimore, MD 21209 > Ph: (+1)-410-706-2296 > www.igs.umaryland.edu/ > > Chair > RSG-Worldwide > ISCB-Student Council > http://iscbsc.org/rsg > > www.bioinfosolutions.com > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > = > ====================================================================== > Attention: The information contained in this message and/or > attachments > from AgResearch Limited is intended only for the persons or entities > to which it is addressed and may contain confidential and/or > privileged > material. Any review, retransmission, dissemination or other use of, > or > taking of any action in reliance upon, this information by persons or > entities other than the intended recipients is prohibited by > AgResearch > Limited. If you have received this message in error, please notify the > sender immediately. > = > ====================================================================== > > > > -- > ----------------------------- > Abhishek Pratap > Bioinformatics Software Engineer > Institute for Genome Sciences > School of Medicine, Univ of Maryland > 801, W. Baltimore Street, Baltimore, MD 21209 > Ph: (+1)-410-706-2296 > www.igs.umaryland.edu/ > > Chair > RSG-Worldwide > ISCB-Student Council > http://iscbsc.org/rsg > > www.bioinfosolutions.com > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > > > > -- > ----------------------------- > Abhishek Pratap > Bioinformatics Software Engineer > Institute for Genome Sciences > School of Medicine, Univ of Maryland > 801, W. Baltimore Street, Baltimore, MD 21209 > Ph: (+1)-410-706-2296 > www.igs.umaryland.edu/ > > Chair > RSG-Worldwide > ISCB-Student Council > http://iscbsc.org/rsg > > www.bioinfosolutions.com > > = > ====================================================================== > Attention: The information contained in this message and/or > attachments > from AgResearch Limited is intended only for the persons or entities > to which it is addressed and may contain confidential and/or > privileged > material. Any review, retransmission, dissemination or other use of, > or > taking of any action in reliance upon, this information by persons or > entities other than the intended recipients is prohibited by > AgResearch > Limited. If you have received this message in error, please notify the > sender immediately. > = > ====================================================================== > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From Russell.Smithies at agresearch.co.nz Tue Jan 6 17:49:42 2009 From: Russell.Smithies at agresearch.co.nz (Smithies, Russell) Date: Wed, 7 Jan 2009 11:49:42 +1300 Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl In-Reply-To: References: <18DF7D20DFEC044098A1062202F5FFF31A69523F20@exchsth.agresearch.co.nz> <18DF7D20DFEC044098A1062202F5FFF31A69523F2D@exchsth.agresearch.co.nz> Message-ID: <18DF7D20DFEC044098A1062202F5FFF31A69523F4D@exchsth.agresearch.co.nz> Sounds like a good plan but I wouldn't know where to start. That level of Perlyness is a bit beyond me :-( --Russell > -----Original Message----- > From: Chris Fields [mailto:cjfields at illinois.edu] > Sent: Wednesday, 7 January 2009 11:13 a.m. > To: Smithies, Russell > Cc: 'Abhishek Pratap'; 'bioperl-l at lists.open-bio.org' > Subject: Re: [Bioperl-l] Parser: Ace file (Sequence Assembly) in > Bioperl > > How about re-implementing Bio::Assembly classes so they simply map to > Bio::DB::SeqFeature::Store (or similar) methods? Scaffold could just > be a wrapper around a Bio::DB::SeqFeature::Store (which can be BDB/ > mysql/postgresql/memory) and return Contigs. > > Similarly, the IO classes could probably act as specialized > Bio::DB::SeqFeature::Store::Loade classes for the database and just > return the Scaffold instance. > > chris > > On Jan 6, 2009, at 3:31 PM, Smithies, Russell wrote: > > > I agree with the need for a faster parser. > > Although the current version does a great job, it is slow and memory > > intensive as it loads everything into Bio::Assembly::Scaffold > > objects composed of Bio::Assembly::Contig objects. > > I'm not sure exactly what the best solution would be, perhaps a new > > constructor with a named contig would simplify things? > > > > $io = new Bio::Assembly::IO(-file=>"454_assy.ace",-format=>"ace"); > > > > $contig = $io->next_assembly_with_contig(-contig=>"Contig000100")- > > >select_contig; > > > > Or do we even need a next_assembly method? > > Can there be more than one assembly in an .ace file? > > > > --Russell > > > > > > > > From: Abhishek Pratap [mailto:abhishek.vit at gmail.com] > > Sent: Wednesday, 7 January 2009 10:07 a.m. > > To: Chris Fields > > Cc: Smithies, Russell; bioperl-l at lists.open-bio.org > > Subject: Re: [Bioperl-l] Parser: Ace file (Sequence Assembly) in > > Bioperl > > > > Ok .. Sure in case we do write something which eventually I will > > have to :) I will fwd it. > > > > @Russel: > > > > I feel to get info for specific the current method is very slow as > > it tries to store the info for all contigs into memory. Such info > > could be memory intensive specially with the next gen data coming > > from 454 sequencers. I think we should grep to the contig/s of > > itnerest and then create a record for it. Please correct me if I am > > wrong. > > > > Thanks, > > -Abhi > > On Tue, Jan 6, 2009 at 3:52 PM, Chris Fields > > >> wrote: > > Not at this time (write_assembly is not implemented). If you come > > up with code to do so let us know (patches are always welcome). > > > > chris > > > > > > On Jan 6, 2009, at 2:43 PM, Abhishek Pratap wrote: > > Thanks that helped. > > > > Any method to write Ace files ? > > > > Thanks, > > -Abhi > > > > On Tue, Jan 6, 2009 at 3:36 PM, Smithies, Russell < > > > Russell.Smithies at agresearch.co.nz .nz > > >> wrote: > > Here's how I've been doing it: > > > > > > my $infile = "454Contigs.ace"; > > my $parser = new Bio::Assembly::IO(-file => $infile ,-format => > > "ace") or > > die $!; > > my $assembly = $parser->next_assembly; > > > > # to work with a named contig > > my @wanted_id = ("Contig100"); > > my ($contig) = $assembly->select_contigs(@wanted_id) or die $!; > > > > #get the consensus > > my $consensus = $contig->get_consensus_sequence(); > > > > #get the consensus qualities > > my @quality_values = @{$contig->get_consensus_quality()->qual()}; > > > > hope this helps, > > > > Russell > > > > -----Original Message----- > > From: bioperl-l-bounces at lists.open-bio.org bounces at lists.open-bio.org > > > [mailto:bioperl-l- > > bounces at lists.open-bio.org] On > > Behalf Of Abhishek Pratap > > Sent: Tuesday, 6 January 2009 6:43 p.m. > > To: bioperl-l at lists.open-bio.org > > Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl > > > > Hi All > > > > I am looking for some code to parse the ACE file format. I have big > > ACE > > files which I would like to trim based on the user defined Contig > name > > and > > specific region and write out the output to another fresh ACE file. > > > > For now I am trying to tweak Bio::Assembly::IO; but it is kind of > > slow. > > Any > > other alternative or suggestions. > > > > Thanks All, > > -Abhi > > > > > > > > > > > > > > > > > > -- > > ----------------------------- > > Abhishek Pratap > > Bioinformatics Software Engineer > > Institute for Genome Sciences > > School of Medicine, Univ of Maryland > > 801, W. Baltimore Street, Baltimore, MD 21209 > > Ph: (+1)-410-706-2296 > > www.igs.umaryland.edu/ > > > > Chair > > RSG-Worldwide > > ISCB-Student Council > > http://iscbsc.org/rsg > > > > www.bioinfosolutions.com > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > = > > > ====================================================================== > > Attention: The information contained in this message and/or > > attachments > > from AgResearch Limited is intended only for the persons or entities > > to which it is addressed and may contain confidential and/or > > privileged > > material. Any review, retransmission, dissemination or other use of, > > or > > taking of any action in reliance upon, this information by persons or > > entities other than the intended recipients is prohibited by > > AgResearch > > Limited. If you have received this message in error, please notify > the > > sender immediately. > > = > > > ====================================================================== > > > > > > > > -- > > ----------------------------- > > Abhishek Pratap > > Bioinformatics Software Engineer > > Institute for Genome Sciences > > School of Medicine, Univ of Maryland > > 801, W. Baltimore Street, Baltimore, MD 21209 > > Ph: (+1)-410-706-2296 > > www.igs.umaryland.edu/ > > > > Chair > > RSG-Worldwide > > ISCB-Student Council > > http://iscbsc.org/rsg > > > > www.bioinfosolutions.com > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > > > > > > > > > -- > > ----------------------------- > > Abhishek Pratap > > Bioinformatics Software Engineer > > Institute for Genome Sciences > > School of Medicine, Univ of Maryland > > 801, W. Baltimore Street, Baltimore, MD 21209 > > Ph: (+1)-410-706-2296 > > www.igs.umaryland.edu/ > > > > Chair > > RSG-Worldwide > > ISCB-Student Council > > http://iscbsc.org/rsg > > > > www.bioinfosolutions.com > > > > = > > > ====================================================================== > > Attention: The information contained in this message and/or > > attachments > > from AgResearch Limited is intended only for the persons or entities > > to which it is addressed and may contain confidential and/or > > privileged > > material. Any review, retransmission, dissemination or other use of, > > or > > taking of any action in reliance upon, this information by persons or > > entities other than the intended recipients is prohibited by > > AgResearch > > Limited. If you have received this message in error, please notify > the > > sender immediately. > > = > > > ====================================================================== > > > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/bioperl-l ======================================================================= Attention: The information contained in this message and/or attachments from AgResearch Limited is intended only for the persons or entities to which it is addressed and may contain confidential and/or privileged material. Any review, retransmission, dissemination or other use of, or taking of any action in reliance upon, this information by persons or entities other than the intended recipients is prohibited by AgResearch Limited. If you have received this message in error, please notify the sender immediately. ======================================================================= From jaudall at gmail.com Tue Jan 6 18:13:45 2009 From: jaudall at gmail.com (Joshua Udall) Date: Tue, 6 Jan 2009 16:13:45 -0700 Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl In-Reply-To: References: <18DF7D20DFEC044098A1062202F5FFF31A69523F20@exchsth.agresearch.co.nz> Message-ID: <52cea20c0901061513x593acb44o641b87e35b8ff6fe@mail.gmail.com> Chris et al. - A student and I have written code to do this - write ace files as well as parse them one entry at a time. In trying to use the Assembly::IO as it was in 1.5, we ran into problems with large ace files containing many entries because of file handle limit issues with the inherited implementation DB_File. Our implementation simply reads one contig at a time instead of first trying to slurp the whole ace into memory. I'm happy to add it to Bioperl, but I am not sure how to do it. If I sent *.pm files to someone, could they help me get it into bioperl? It may not be perfect either, but it should be a good start. Josh On Tue, Jan 6, 2009 at 1:52 PM, Chris Fields wrote: > Not at this time (write_assembly is not implemented). If you come up with > code to do so let us know (patches are always welcome). > > chris > > > On Jan 6, 2009, at 2:43 PM, Abhishek Pratap wrote: > > Thanks that helped. >> >> Any method to write Ace files ? >> >> Thanks, >> -Abhi >> >> On Tue, Jan 6, 2009 at 3:36 PM, Smithies, Russell < >> Russell.Smithies at agresearch.co.nz> wrote: >> >> Here's how I've been doing it: >>> >>> >>> my $infile = "454Contigs.ace"; >>> my $parser = new Bio::Assembly::IO(-file => $infile ,-format => "ace") >>> or >>> die $!; >>> my $assembly = $parser->next_assembly; >>> >>> # to work with a named contig >>> my @wanted_id = ("Contig100"); >>> my ($contig) = $assembly->select_contigs(@wanted_id) or die $!; >>> >>> #get the consensus >>> my $consensus = $contig->get_consensus_sequence(); >>> >>> #get the consensus qualities >>> my @quality_values = @{$contig->get_consensus_quality()->qual()}; >>> >>> hope this helps, >>> >>> Russell >>> >>> >>> -----Original Message----- >>>> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l- >>>> bounces at lists.open-bio.org] On Behalf Of Abhishek Pratap >>>> Sent: Tuesday, 6 January 2009 6:43 p.m. >>>> To: bioperl-l at lists.open-bio.org >>>> Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl >>>> >>>> Hi All >>>> >>>> I am looking for some code to parse the ACE file format. I have big ACE >>>> files which I would like to trim based on the user defined Contig name >>>> and >>>> specific region and write out the output to another fresh ACE file. >>>> >>>> For now I am trying to tweak Bio::Assembly::IO; but it is kind of slow. >>>> Any >>>> other alternative or suggestions. >>>> >>>> Thanks All, >>>> -Abhi >>>> >>>> >>>> >>>> >>>> >>>> >>>> >>>> >>>> -- >>>> ----------------------------- >>>> Abhishek Pratap >>>> Bioinformatics Software Engineer >>>> Institute for Genome Sciences >>>> School of Medicine, Univ of Maryland >>>> 801, W. Baltimore Street, Baltimore, MD 21209 >>>> Ph: (+1)-410-706-2296 >>>> www.igs.umaryland.edu/ >>>> >>>> Chair >>>> RSG-Worldwide >>>> ISCB-Student Council >>>> http://iscbsc.org/rsg >>>> >>>> www.bioinfosolutions.com >>>> _______________________________________________ >>>> Bioperl-l mailing list >>>> Bioperl-l at lists.open-bio.org >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>> >>> ======================================================================= >>> Attention: The information contained in this message and/or attachments >>> from AgResearch Limited is intended only for the persons or entities >>> to which it is addressed and may contain confidential and/or privileged >>> material. Any review, retransmission, dissemination or other use of, or >>> taking of any action in reliance upon, this information by persons or >>> entities other than the intended recipients is prohibited by AgResearch >>> Limited. If you have received this message in error, please notify the >>> sender immediately. >>> ======================================================================= >>> >>> >> >> >> -- >> ----------------------------- >> Abhishek Pratap >> Bioinformatics Software Engineer >> Institute for Genome Sciences >> School of Medicine, Univ of Maryland >> 801, W. Baltimore Street, Baltimore, MD 21209 >> Ph: (+1)-410-706-2296 >> www.igs.umaryland.edu/ >> >> Chair >> RSG-Worldwide >> ISCB-Student Council >> http://iscbsc.org/rsg >> >> www.bioinfosolutions.com >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > -- Joshua Udall Assistant Professor 295 WIDB Plant and Wildlife Science Dept. Brigham Young University Provo, UT 84602 801-422-9307 Fax: 801-422-0008 USA From cjfields at illinois.edu Tue Jan 6 18:22:50 2009 From: cjfields at illinois.edu (Chris Fields) Date: Tue, 6 Jan 2009 17:22:50 -0600 Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl In-Reply-To: <52cea20c0901061513x593acb44o641b87e35b8ff6fe@mail.gmail.com> References: <18DF7D20DFEC044098A1062202F5FFF31A69523F20@exchsth.agresearch.co.nz> <52cea20c0901061513x593acb44o641b87e35b8ff6fe@mail.gmail.com> Message-ID: <835D79AC-0D2A-40BE-87F1-0591F69C036A@illinois.edu> Could you archive the files and attach them to a bug report (you can mark it as an enhancement request). We can take a look. http://bugzilla.open-bio.org/ chris On Jan 6, 2009, at 5:13 PM, Joshua Udall wrote: > Chris et al. - > > A student and I have written code to do this - write ace files as > well as > parse them one entry at a time. In trying to use the Assembly::IO > as it was > in 1.5, we ran into problems with large ace files containing many > entries > because of file handle limit issues with the inherited implementation > DB_File. Our implementation simply reads one contig at a time > instead of > first trying to slurp the whole ace into memory. I'm happy to add > it to > Bioperl, but I am not sure how to do it. If I sent *.pm files to > someone, > could they help me get it into bioperl? It may not be perfect > either, but > it should be a good start. > > Josh > > On Tue, Jan 6, 2009 at 1:52 PM, Chris Fields > wrote: > >> Not at this time (write_assembly is not implemented). If you come >> up with >> code to do so let us know (patches are always welcome). >> >> chris >> >> >> On Jan 6, 2009, at 2:43 PM, Abhishek Pratap wrote: >> >> Thanks that helped. >>> >>> Any method to write Ace files ? >>> >>> Thanks, >>> -Abhi >>> >>> On Tue, Jan 6, 2009 at 3:36 PM, Smithies, Russell < >>> Russell.Smithies at agresearch.co.nz> wrote: >>> >>> Here's how I've been doing it: >>>> >>>> >>>> my $infile = "454Contigs.ace"; >>>> my $parser = new Bio::Assembly::IO(-file => $infile ,-format => >>>> "ace") >>>> or >>>> die $!; >>>> my $assembly = $parser->next_assembly; >>>> >>>> # to work with a named contig >>>> my @wanted_id = ("Contig100"); >>>> my ($contig) = $assembly->select_contigs(@wanted_id) or die $!; >>>> >>>> #get the consensus >>>> my $consensus = $contig->get_consensus_sequence(); >>>> >>>> #get the consensus qualities >>>> my @quality_values = @{$contig->get_consensus_quality()->qual()}; >>>> >>>> hope this helps, >>>> >>>> Russell >>>> >>>> >>>> -----Original Message----- >>>>> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l- >>>>> bounces at lists.open-bio.org] On Behalf Of Abhishek Pratap >>>>> Sent: Tuesday, 6 January 2009 6:43 p.m. >>>>> To: bioperl-l at lists.open-bio.org >>>>> Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in >>>>> Bioperl >>>>> >>>>> Hi All >>>>> >>>>> I am looking for some code to parse the ACE file format. I have >>>>> big ACE >>>>> files which I would like to trim based on the user defined >>>>> Contig name >>>>> and >>>>> specific region and write out the output to another fresh ACE >>>>> file. >>>>> >>>>> For now I am trying to tweak Bio::Assembly::IO; but it is kind >>>>> of slow. >>>>> Any >>>>> other alternative or suggestions. >>>>> >>>>> Thanks All, >>>>> -Abhi >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> >>>>> -- >>>>> ----------------------------- >>>>> Abhishek Pratap >>>>> Bioinformatics Software Engineer >>>>> Institute for Genome Sciences >>>>> School of Medicine, Univ of Maryland >>>>> 801, W. Baltimore Street, Baltimore, MD 21209 >>>>> Ph: (+1)-410-706-2296 >>>>> www.igs.umaryland.edu/ >>>>> >>>>> Chair >>>>> RSG-Worldwide >>>>> ISCB-Student Council >>>>> http://iscbsc.org/rsg >>>>> >>>>> www.bioinfosolutions.com >>>>> _______________________________________________ >>>>> Bioperl-l mailing list >>>>> Bioperl-l at lists.open-bio.org >>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>>> >>>> = >>>> = >>>> = >>>> = >>>> =================================================================== >>>> Attention: The information contained in this message and/or >>>> attachments >>>> from AgResearch Limited is intended only for the persons or >>>> entities >>>> to which it is addressed and may contain confidential and/or >>>> privileged >>>> material. Any review, retransmission, dissemination or other use >>>> of, or >>>> taking of any action in reliance upon, this information by >>>> persons or >>>> entities other than the intended recipients is prohibited by >>>> AgResearch >>>> Limited. If you have received this message in error, please >>>> notify the >>>> sender immediately. >>>> = >>>> = >>>> = >>>> = >>>> =================================================================== >>>> >>>> >>> >>> >>> -- >>> ----------------------------- >>> Abhishek Pratap >>> Bioinformatics Software Engineer >>> Institute for Genome Sciences >>> School of Medicine, Univ of Maryland >>> 801, W. Baltimore Street, Baltimore, MD 21209 >>> Ph: (+1)-410-706-2296 >>> www.igs.umaryland.edu/ >>> >>> Chair >>> RSG-Worldwide >>> ISCB-Student Council >>> http://iscbsc.org/rsg >>> >>> www.bioinfosolutions.com >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>> >> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > > > > -- > Joshua Udall > Assistant Professor > 295 WIDB > Plant and Wildlife Science Dept. > Brigham Young University > Provo, UT 84602 > 801-422-9307 > Fax: 801-422-0008 > USA > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From cjfields at illinois.edu Tue Jan 6 18:23:38 2009 From: cjfields at illinois.edu (Chris Fields) Date: Tue, 6 Jan 2009 17:23:38 -0600 Subject: [Bioperl-l] [ANNOUCEMENT] BioPerl 1.6 RC2 Message-ID: <461D1DC4-F522-47EA-B4FB-982B9F80013C@illinois.edu> All, All, I am like to announce the second release candidate for BioPerl 1.6 is available for testing. A quick note on versioning: due to issues with alpha numbered versions on CPAN possibly overwriting a stable release, this release candidate has a VERSION of 1.005009_002 (or 1.005009002). This will be switched to 1.006000 (no alpha) once the release is final. The RC is currently being uploaded to CPAN and should be available in the next 24-48 hours under authorname CJFIELDS. In the meantime, the release candidates can be directly downloaded here: http://bioperl.org/DIST/BioPerl-1.5.9_2.tar.bz2 http://bioperl.org/DIST/BioPerl-1.5.9_2.tar.gz http://bioperl.org/DIST/BioPerl-1.5.9_2.zip Signature file: http://bioperl.org/DIST/SIGNATURES.md5 A preliminary ActiveState PPM is also available and is located in the BioPerl Release Candidate repository; the directions for installation are here: http://www.bioperl.org/wiki/Installing_Bioperl_on_Windows Please feel free to report issues with testing, installation, etc. on the mail list and on this page: http://www.bioperl.org/wiki/Release_1.6_Testing Again, just to note we will be releasing bioperl-run, bioperl-db, bioperl-network, and others separately once the final 1.6 release is complete. Since the last release: Fixed: 1) Some cruft from testing the last release is no longer present. 2) Several warnings and test failures (via CPAN Testers) now fixed. Known Issues: 1) A very recent change in ENSembl data causes one of the Map.t tests to fail; this has already been fixed and will be present in the next (final?) release. 2) Some odd warnings for Bio::Assembly tests are still present, but they are harmless. Nevertheless they will be addressed prior to the next release. 3) Warnings for Bio::Annotation tests can be fixed by an upgrade to the latest Data::Stag (this is NOT a required upgrade). 4) PPM issues; note this is not high on our priority list ATM but I will try to address it for the next release). Enjoy! chris From maj at fortinbras.us Tue Jan 6 22:33:34 2009 From: maj at fortinbras.us (Mark A. Jensen) Date: Tue, 6 Jan 2009 22:33:34 -0500 Subject: [Bioperl-l] The Power of R Message-ID: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife> So says the New York Times: http://www.nytimes.com/2009/01/07/technology/business-computing/07program.html From cjfields at illinois.edu Wed Jan 7 00:04:14 2009 From: cjfields at illinois.edu (Chris Fields) Date: Tue, 6 Jan 2009 23:04:14 -0600 Subject: [Bioperl-l] The Power of R In-Reply-To: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife> References: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife> Message-ID: <56AC3EAA-715D-4E0B-928C-37FAE78C1DDF@illinois.edu> Now if we can only get a decent Perl-R interface which isn't a PITA to install... chris On Jan 6, 2009, at 9:33 PM, Mark A. Jensen wrote: > So says the New York Times: > http://www.nytimes.com/2009/01/07/technology/business-computing/07program.html > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From umylny at apbri.org Wed Jan 7 00:34:35 2009 From: umylny at apbri.org (Boris Umylny) Date: Wed, 7 Jan 2009 14:34:35 +0900 Subject: [Bioperl-l] The Power of R In-Reply-To: <56AC3EAA-715D-4E0B-928C-37FAE78C1DDF@illinois.edu> References: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife> <56AC3EAA-715D-4E0B-928C-37FAE78C1DDF@illinois.edu> Message-ID: <0C22B476CF534F60933CCA206D62C81F@UmylnyLaptop> What do you think of RSPerl (http://www.omegahat.org/RSPerl/)? Boris ----- Original Message ----- From: "Chris Fields" To: "Mark A. Jensen" Cc: Sent: Wednesday, January 07, 2009 2:04 PM Subject: Re: [Bioperl-l] The Power of R > Now if we can only get a decent Perl-R interface which isn't a PITA to > install... > > chris > > On Jan 6, 2009, at 9:33 PM, Mark A. Jensen wrote: > >> So says the New York Times: >> http://www.nytimes.com/2009/01/07/technology/business-computing/07program.html >> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > From David.Messina at sbc.su.se Wed Jan 7 07:45:13 2009 From: David.Messina at sbc.su.se (Dave Messina) Date: Wed, 7 Jan 2009 13:45:13 +0100 Subject: [Bioperl-l] The Power of R In-Reply-To: <0C22B476CF534F60933CCA206D62C81F@UmylnyLaptop> References: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife> <56AC3EAA-715D-4E0B-928C-37FAE78C1DDF@illinois.edu> <0C22B476CF534F60933CCA206D62C81F@UmylnyLaptop> Message-ID: <628aabb70901070445w1f68da86v829b5e310c765b20@mail.gmail.com> While we're on the topic, can anyone recommend a good book or resource from which to learn R, to supplement the official docs? From cjfields at illinois.edu Wed Jan 7 08:26:14 2009 From: cjfields at illinois.edu (Chris Fields) Date: Wed, 7 Jan 2009 07:26:14 -0600 Subject: [Bioperl-l] The Power of R In-Reply-To: <0C22B476CF534F60933CCA206D62C81F@UmylnyLaptop> References: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife> <56AC3EAA-715D-4E0B-928C-37FAE78C1DDF@illinois.edu> <0C22B476CF534F60933CCA206D62C81F@UmylnyLaptop> Message-ID: <5898CC7F-1A85-4666-AC9E-4C30B10F5348@illinois.edu> Not to bash this, as it is a decent piece of software, but... : > 1) Painful to install, and doesn't support a local perl installation (keeps attempting to go back and use my 5.8.8 instead of my local 5.10). 2) Not on CPAN. 3) Though this is supposed to be bidirectional, R from Perl is not well supported and apparently does not work for Windows. 4) Doesn't appear to be well-supported in general. I do not intend on writing a full perl suite for R/BioC analyses if I end up having to work around problems with the critical module. -c On Jan 6, 2009, at 11:34 PM, Boris Umylny wrote: > What do you think of RSPerl (http://www.omegahat.org/RSPerl/)? > > > Boris > > > ----- Original Message ----- From: "Chris Fields" > > To: "Mark A. Jensen" > Cc: > Sent: Wednesday, January 07, 2009 2:04 PM > Subject: Re: [Bioperl-l] The Power of R > > >> Now if we can only get a decent Perl-R interface which isn't a PITA >> to install... >> >> chris >> >> On Jan 6, 2009, at 9:33 PM, Mark A. Jensen wrote: >> >>> So says the New York Times: >>> http://www.nytimes.com/2009/01/07/technology/business-computing/07program.html >>> >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > From cjfields at illinois.edu Wed Jan 7 08:26:54 2009 From: cjfields at illinois.edu (Chris Fields) Date: Wed, 7 Jan 2009 07:26:54 -0600 Subject: [Bioperl-l] The Power of R In-Reply-To: <628aabb70901070445w1f68da86v829b5e310c765b20@mail.gmail.com> References: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife> <56AC3EAA-715D-4E0B-928C-37FAE78C1DDF@illinois.edu> <0C22B476CF534F60933CCA206D62C81F@UmylnyLaptop> <628aabb70901070445w1f68da86v829b5e310c765b20@mail.gmail.com> Message-ID: <520F0236-45B5-4B4C-B870-DD72A9FD0F51@illinois.edu> Inexpensive and good: I use 'A Handbook of Statistical Analyses Using R' by Everitt and Hothorn. 'Bioconductor Case Studies (Use R)' is supposed to be good, just haven't checked it out myself. Mark's suggestions are good also, though I do not recommend 'R Programming in Bioinformatics' except as a book to demonstrate basic analyses using R (and a bit overpriced one at that). chris On Jan 7, 2009, at 6:45 AM, Dave Messina wrote: > While we're on the topic, can anyone recommend a good book or > resource from which to learn R, to supplement the official docs? > > From maj at fortinbras.us Wed Jan 7 08:08:55 2009 From: maj at fortinbras.us (Mark A. Jensen) Date: Wed, 7 Jan 2009 08:08:55 -0500 Subject: [Bioperl-l] The Power of R In-Reply-To: <628aabb70901070445w1f68da86v829b5e310c765b20@mail.gmail.com> References: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife><56AC3EAA-715D-4E0B-928C-37FAE78C1DDF@illinois.edu><0C22B476CF534F60933CCA206D62C81F@UmylnyLaptop> <628aabb70901070445w1f68da86v829b5e310c765b20@mail.gmail.com> Message-ID: You might check out http://www.amazon.com/Programming-Bioinformatics-Chapman-Computer-Analysis/dp/1420063677/ref=pd_sim_b_35 http://www.amazon.com/R-Book-Michael-J-Crawley/dp/0470510242/ref=pd_sim_b_njs_4 and http://www.amazon.com/Introduction-R-W-N-Venables/dp/0954161742/ref=pd_sim_b_15 ----- Original Message ----- From: "Dave Messina" To: "Boris Umylny" Cc: "Chris Fields" ; Sent: Wednesday, January 07, 2009 7:45 AM Subject: Re: [Bioperl-l] The Power of R > While we're on the topic, can anyone recommend a good book or resource from > which to learn R, to supplement the official docs? > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > From sdavis2 at mail.nih.gov Wed Jan 7 09:01:43 2009 From: sdavis2 at mail.nih.gov (Sean Davis) Date: Wed, 7 Jan 2009 09:01:43 -0500 Subject: [Bioperl-l] The Power of R In-Reply-To: <5898CC7F-1A85-4666-AC9E-4C30B10F5348@illinois.edu> References: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife> <56AC3EAA-715D-4E0B-928C-37FAE78C1DDF@illinois.edu> <0C22B476CF534F60933CCA206D62C81F@UmylnyLaptop> <5898CC7F-1A85-4666-AC9E-4C30B10F5348@illinois.edu> Message-ID: <264855a00901070601k68ab5fa4ibb904a1a511636d7@mail.gmail.com> I agree with Chris, here. RSPerl has potential, but it really isn't a fantastic solution. Compare to Rpy for python, for example, to see the very significant differences in usability. To take another route altogether, one could consider using something like RServe which provides a SOAP interface to R and then using SOAP calls to the server to accomplish the tasks. This will have some overhead, but for most reasonable data sets, should be relatively painless. Sean On Wed, Jan 7, 2009 at 8:26 AM, Chris Fields wrote: > Not to bash this, as it is a decent piece of software, but... : > > > 1) Painful to install, and doesn't support a local perl installation (keeps > attempting to go back and use my 5.8.8 instead of my local 5.10). > 2) Not on CPAN. > 3) Though this is supposed to be bidirectional, R from Perl is not well > supported and apparently does not work for Windows. > 4) Doesn't appear to be well-supported in general. > > I do not intend on writing a full perl suite for R/BioC analyses if I end > up having to work around problems with the critical module. > > -c > > On Jan 6, 2009, at 11:34 PM, Boris Umylny wrote: > > What do you think of RSPerl (http://www.omegahat.org/RSPerl/)? >> >> >> Boris >> >> >> ----- Original Message ----- From: "Chris Fields" >> To: "Mark A. Jensen" >> Cc: >> Sent: Wednesday, January 07, 2009 2:04 PM >> Subject: Re: [Bioperl-l] The Power of R >> >> >> Now if we can only get a decent Perl-R interface which isn't a PITA to >>> install... >>> >>> chris >>> >>> On Jan 6, 2009, at 9:33 PM, Mark A. Jensen wrote: >>> >>> So says the New York Times: >>>> >>>> http://www.nytimes.com/2009/01/07/technology/business-computing/07program.html >>>> >>>> _______________________________________________ >>>> Bioperl-l mailing list >>>> Bioperl-l at lists.open-bio.org >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>> >>> >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>> >> >> > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > From sdavis2 at mail.nih.gov Wed Jan 7 09:05:04 2009 From: sdavis2 at mail.nih.gov (Sean Davis) Date: Wed, 7 Jan 2009 09:05:04 -0500 Subject: [Bioperl-l] The Power of R In-Reply-To: <628aabb70901070445w1f68da86v829b5e310c765b20@mail.gmail.com> References: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife> <56AC3EAA-715D-4E0B-928C-37FAE78C1DDF@illinois.edu> <0C22B476CF534F60933CCA206D62C81F@UmylnyLaptop> <628aabb70901070445w1f68da86v829b5e310c765b20@mail.gmail.com> Message-ID: <264855a00901070605o136431ew208d6c4fa780d50e@mail.gmail.com> On Wed, Jan 7, 2009 at 7:45 AM, Dave Messina wrote: > While we're on the topic, can anyone recommend a good book or resource from > which to learn R, to supplement the official docs? > Check out the Bioconductor Site. In particular here: http://bioconductor.org/GettingStarted If you click on the "Workshops" link, it will give you a list of dates. The workshop materials are online and generally pretty good and topic-specific. Sean From maj at fortinbras.us Wed Jan 7 09:14:59 2009 From: maj at fortinbras.us (Mark A. Jensen) Date: Wed, 7 Jan 2009 09:14:59 -0500 Subject: [Bioperl-l] The Power of R In-Reply-To: <56AC3EAA-715D-4E0B-928C-37FAE78C1DDF@illinois.edu> References: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife> <56AC3EAA-715D-4E0B-928C-37FAE78C1DDF@illinois.edu> Message-ID: <9F668F00C72C449BBD961E547AA21BB9@NewLife> Quote from article: "I think it addresses a niche market for high-end data analysts that want free, readily available code," said Anne H. Milley, director of technology product marketing at SAS. She adds, "We have customers who build engines for aircraft. I am happy they are not using freeware when I get on a jet." Ignoring for the moment that avionics is probably in the 'high-end' category, I'm wondering how much "freeware" (ahem..) is controlling mission-critical operations around the world. I would choose "freeware" by Venables, Ihaka, and Gentleman (not to mention, say, Wall...) over bloated, slow, overpriced, etc etc etc, anyday. Hey, in fact I do! (Thanks for the oppy to vent.) ----- Original Message ----- From: "Chris Fields" To: "Mark A. Jensen" Cc: Sent: Wednesday, January 07, 2009 12:04 AM Subject: Re: [Bioperl-l] The Power of R > Now if we can only get a decent Perl-R interface which isn't a PITA to > install... > > chris > > On Jan 6, 2009, at 9:33 PM, Mark A. Jensen wrote: > >> So says the New York Times: >> http://www.nytimes.com/2009/01/07/technology/business-computing/07program.html >> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > > > From David.Messina at sbc.su.se Wed Jan 7 09:34:22 2009 From: David.Messina at sbc.su.se (Dave Messina) Date: Wed, 7 Jan 2009 15:34:22 +0100 Subject: [Bioperl-l] The Power of R In-Reply-To: <264855a00901070605o136431ew208d6c4fa780d50e@mail.gmail.com> References: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife> <56AC3EAA-715D-4E0B-928C-37FAE78C1DDF@illinois.edu> <0C22B476CF534F60933CCA206D62C81F@UmylnyLaptop> <628aabb70901070445w1f68da86v829b5e310c765b20@mail.gmail.com> <264855a00901070605o136431ew208d6c4fa780d50e@mail.gmail.com> Message-ID: <628aabb70901070634g30d299afla23ae068227adf55@mail.gmail.com> Awesome -- thanks for all the suggestions, guys. Dave From ian.simpson at ed.ac.uk Wed Jan 7 09:55:59 2009 From: ian.simpson at ed.ac.uk (Dr. T. I. Simpson) Date: Wed, 07 Jan 2009 14:55:59 -0000 Subject: [Bioperl-l] The Power of R In-Reply-To: <5898CC7F-1A85-4666-AC9E-4C30B10F5348@illinois.edu> References: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife> <56AC3EAA-715D-4E0B-928C-37FAE78C1DDF@illinois.edu> <0C22B476CF534F60933CCA206D62C81F@UmylnyLaptop> <5898CC7F-1A85-4666-AC9E-4C30B10F5348@illinois.edu> Message-ID: I agree with Chris on this. Used RSPerl about a year ago to integrate some clustering experiments in R with a Perl script that fed data to R and picked up output, but it was mighty painful and accessing R objects through RSPerl was indeed a PITA. Ian. On Wed, 07 Jan 2009 13:26:14 -0000, Chris Fields wrote: > Not to bash this, as it is a decent piece of software, but... : > > > 1) Painful to install, and doesn't support a local perl installation > (keeps attempting to go back and use my 5.8.8 instead of my local 5.10). > 2) Not on CPAN. > 3) Though this is supposed to be bidirectional, R from Perl is not well > supported and apparently does not work for Windows. > 4) Doesn't appear to be well-supported in general. > > I do not intend on writing a full perl suite for R/BioC analyses if I > end up having to work around problems with the critical module. > > -c > > On Jan 6, 2009, at 11:34 PM, Boris Umylny wrote: > >> What do you think of RSPerl (http://www.omegahat.org/RSPerl/)? >> >> >> Boris >> >> >> ----- Original Message ----- From: "Chris Fields" > > >> To: "Mark A. Jensen" >> Cc: >> Sent: Wednesday, January 07, 2009 2:04 PM >> Subject: Re: [Bioperl-l] The Power of R >> >> >>> Now if we can only get a decent Perl-R interface which isn't a PITA to >>> install... >>> >>> chris >>> >>> On Jan 6, 2009, at 9:33 PM, Mark A. Jensen wrote: >>> >>>> So says the New York Times: >>>> http://www.nytimes.com/2009/01/07/technology/business-computing/07program.html >>>> >>>> _______________________________________________ >>>> Bioperl-l mailing list >>>> Bioperl-l at lists.open-bio.org >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>> >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > -- Dr T. I. Simpson School of Biomedical Sciences University of Edinburgh Hugh Robson Building George Square Edinburgh EH8 9XD ian.simpson at ed.ac.uk The University of Edinburgh is a charitable body, registered in Scotland, with registration number SC005336. From maj at fortinbras.us Wed Jan 7 10:19:44 2009 From: maj at fortinbras.us (Mark A. Jensen) Date: Wed, 7 Jan 2009 10:19:44 -0500 Subject: [Bioperl-l] The Power of R In-Reply-To: References: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife><56AC3EAA-715D-4E0B-928C-37FAE78C1DDF@illinois.edu><0C22B476CF534F60933CCA206D62C81F@UmylnyLaptop><5898CC7F-1A85-4666-AC9E-4C30B10F5348@illinois.edu> Message-ID: <63F5396BCA044FB99AC6B543A52F2EA4@NewLife> What solution did you responders wind up using? Do people generally get RSPerl to work and wash their hands of it afterwards? Or do you finally hand-code a good deal? thx ----- Original Message ----- From: "Dr. T. I. Simpson" To: "Chris Fields" ; "Boris Umylny" Cc: Sent: Wednesday, January 07, 2009 9:55 AM Subject: Re: [Bioperl-l] The Power of R >I agree with Chris on this. > > Used RSPerl about a year ago to integrate some clustering experiments in R > with a Perl script that fed data to R and picked up output, but it was mighty > painful and accessing R objects through RSPerl was indeed a PITA. > > Ian. > > > On Wed, 07 Jan 2009 13:26:14 -0000, Chris Fields > wrote: > >> Not to bash this, as it is a decent piece of software, but... : > >> >> 1) Painful to install, and doesn't support a local perl installation (keeps >> attempting to go back and use my 5.8.8 instead of my local 5.10). >> 2) Not on CPAN. >> 3) Though this is supposed to be bidirectional, R from Perl is not well >> supported and apparently does not work for Windows. >> 4) Doesn't appear to be well-supported in general. >> >> I do not intend on writing a full perl suite for R/BioC analyses if I end up >> having to work around problems with the critical module. >> >> -c >> >> On Jan 6, 2009, at 11:34 PM, Boris Umylny wrote: >> >>> What do you think of RSPerl (http://www.omegahat.org/RSPerl/)? >>> >>> >>> Boris >>> >>> >>> ----- Original Message ----- From: "Chris Fields" >> > >>> To: "Mark A. Jensen" >>> Cc: >>> Sent: Wednesday, January 07, 2009 2:04 PM >>> Subject: Re: [Bioperl-l] The Power of R >>> >>> >>>> Now if we can only get a decent Perl-R interface which isn't a PITA to >>>> install... >>>> >>>> chris >>>> >>>> On Jan 6, 2009, at 9:33 PM, Mark A. Jensen wrote: >>>> >>>>> So says the New York Times: >>>>> http://www.nytimes.com/2009/01/07/technology/business-computing/07program.html >>>>> >>>>> _______________________________________________ >>>>> Bioperl-l mailing list >>>>> Bioperl-l at lists.open-bio.org >>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>> >>>> _______________________________________________ >>>> Bioperl-l mailing list >>>> Bioperl-l at lists.open-bio.org >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>> >> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > > > > -- > Dr T. I. Simpson > School of Biomedical Sciences > University of Edinburgh > Hugh Robson Building > George Square > Edinburgh > EH8 9XD > > ian.simpson at ed.ac.uk > > > The University of Edinburgh is a charitable body, registered in > Scotland, with registration number SC005336. > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > From cjfields at illinois.edu Wed Jan 7 10:49:52 2009 From: cjfields at illinois.edu (Chris Fields) Date: Wed, 7 Jan 2009 09:49:52 -0600 Subject: [Bioperl-l] The Power of R In-Reply-To: <9F668F00C72C449BBD961E547AA21BB9@NewLife> References: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife> <56AC3EAA-715D-4E0B-928C-37FAE78C1DDF@illinois.edu> <9F668F00C72C449BBD961E547AA21BB9@NewLife> Message-ID: <2BD2BAB8-6486-4349-8124-3A8B6392D9E8@illinois.edu> I agree completely. On an ironic note (quoted from 'Programming Perl'): External Testing Modules uploaded to CPAN are tested by a variety of volunteers on different platforms. These CPAN testers are notified by mail of each new upload, and reply to the list with PASS, FAIL, NA (not applicable to this platform), or UNKNOWN (unknown), along with any relevant notations. You can find the mailing list for CPAN testers at cpan-testers at perl.org ; test results are posted at http://testers.cpan.org/. That's all just the preliminary testing, of course. The real testing begins when someone plugs your little module into a web server that's cranking out a million pages a day. Or uses your module to help design the airplane you'll be riding in someday soon. So go ahead, skip writing those pesky little tests. See if we care... chris On Jan 7, 2009, at 8:14 AM, Mark A. Jensen wrote: > Quote from article: > "I think it addresses a niche market for high-end data analysts that > want free, readily available code," said Anne H. Milley, director of > technology product marketing at SAS. She adds, "We have customers > who build engines for aircraft. I am happy they are not using > freeware when I get on a jet." > > Ignoring for the moment that avionics is probably in the 'high-end' > category, I'm wondering how much "freeware" (ahem..) is controlling > mission-critical operations around the world. > > I would choose "freeware" by Venables, Ihaka, and Gentleman (not to > mention, say, Wall...) over bloated, slow, overpriced, etc etc etc, > anyday. Hey, in fact I do! > > (Thanks for the oppy to vent.) > ----- Original Message ----- From: "Chris Fields" > > To: "Mark A. Jensen" > Cc: > Sent: Wednesday, January 07, 2009 12:04 AM > Subject: Re: [Bioperl-l] The Power of R > > >> Now if we can only get a decent Perl-R interface which isn't a PITA >> to install... >> >> chris >> >> On Jan 6, 2009, at 9:33 PM, Mark A. Jensen wrote: >> >>> So says the New York Times: >>> http://www.nytimes.com/2009/01/07/technology/business-computing/07program.html >>> >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> >> > From ian.simpson at ed.ac.uk Wed Jan 7 10:32:48 2009 From: ian.simpson at ed.ac.uk (Dr. T. I. Simpson) Date: Wed, 07 Jan 2009 15:32:48 -0000 Subject: [Bioperl-l] The Power of R In-Reply-To: <63F5396BCA044FB99AC6B543A52F2EA4@NewLife> References: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife> <56AC3EAA-715D-4E0B-928C-37FAE78C1DDF@illinois.edu> <0C22B476CF534F60933CCA206D62C81F@UmylnyLaptop> <5898CC7F-1A85-4666-AC9E-4C30B10F5348@illinois.edu> <63F5396BCA044FB99AC6B543A52F2EA4@NewLife> Message-ID: I did use RSPerl but was deeply displeased with what was simply a solution born of necessity at the time. It got the job done, but was not a long term solution. I look likely to revisit the throny issue in the next couple of months as I am trying to package up some simple downstream clustering analysis code into a bioperl package. I would dearly love to have it all nicely connected up to R, so am keeping an eye on the some threads that are running on BioC/BioPerl integration and the potential to use BioLib for this purpose http://biolib.open-bio.org/wiki/Main_Page. I know painfully little about this at the moment, but plan to gen up in the coming weeks. Ian. On Wed, 07 Jan 2009 15:19:44 -0000, Mark A. Jensen wrote: > What solution did you responders wind up using? Do people generally get > RSPerl to work and wash their hands of it afterwards? Or do you finally > hand-code a good deal? thx > ----- Original Message ----- From: "Dr. T. I. Simpson" > > To: "Chris Fields" ; "Boris Umylny" > > Cc: > Sent: Wednesday, January 07, 2009 9:55 AM > Subject: Re: [Bioperl-l] The Power of R > > >> I agree with Chris on this. >> >> Used RSPerl about a year ago to integrate some clustering experiments >> in R with a Perl script that fed data to R and picked up output, but it >> was mighty painful and accessing R objects through RSPerl was indeed a >> PITA. >> >> Ian. >> >> >> On Wed, 07 Jan 2009 13:26:14 -0000, Chris Fields >> wrote: >> >>> Not to bash this, as it is a decent piece of software, but... : > >>> >>> 1) Painful to install, and doesn't support a local perl installation >>> (keeps attempting to go back and use my 5.8.8 instead of my local >>> 5.10). >>> 2) Not on CPAN. >>> 3) Though this is supposed to be bidirectional, R from Perl is not >>> well supported and apparently does not work for Windows. >>> 4) Doesn't appear to be well-supported in general. >>> >>> I do not intend on writing a full perl suite for R/BioC analyses if I >>> end up having to work around problems with the critical module. >>> >>> -c >>> >>> On Jan 6, 2009, at 11:34 PM, Boris Umylny wrote: >>> >>>> What do you think of RSPerl (http://www.omegahat.org/RSPerl/)? >>>> >>>> >>>> Boris >>>> >>>> >>>> ----- Original Message ----- From: "Chris Fields" >>>> >>> > >>>> To: "Mark A. Jensen" >>>> Cc: >>>> Sent: Wednesday, January 07, 2009 2:04 PM >>>> Subject: Re: [Bioperl-l] The Power of R >>>> >>>> >>>>> Now if we can only get a decent Perl-R interface which isn't a PITA >>>>> to install... >>>>> >>>>> chris >>>>> >>>>> On Jan 6, 2009, at 9:33 PM, Mark A. Jensen wrote: >>>>> >>>>>> So says the New York Times: >>>>>> http://www.nytimes.com/2009/01/07/technology/business-computing/07program.html >>>>>> >>>>>> _______________________________________________ >>>>>> Bioperl-l mailing list >>>>>> Bioperl-l at lists.open-bio.org >>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>>> >>>>> _______________________________________________ >>>>> Bioperl-l mailing list >>>>> Bioperl-l at lists.open-bio.org >>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>> >>> >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>> >> >> >> >> -- Dr T. I. Simpson >> School of Biomedical Sciences >> University of Edinburgh >> Hugh Robson Building >> George Square >> Edinburgh >> EH8 9XD >> >> ian.simpson at ed.ac.uk >> >> >> The University of Edinburgh is a charitable body, registered in >> Scotland, with registration number SC005336. >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> >> > > -- Dr T. I. Simpson School of Biomedical Sciences University of Edinburgh Hugh Robson Building George Square Edinburgh EH8 9XD ian.simpson at ed.ac.uk The University of Edinburgh is a charitable body, registered in Scotland, with registration number SC005336. From cjfields at illinois.edu Wed Jan 7 10:58:47 2009 From: cjfields at illinois.edu (Chris Fields) Date: Wed, 7 Jan 2009 09:58:47 -0600 Subject: [Bioperl-l] The Power of R In-Reply-To: References: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife> <56AC3EAA-715D-4E0B-928C-37FAE78C1DDF@illinois.edu> <0C22B476CF534F60933CCA206D62C81F@UmylnyLaptop> <5898CC7F-1A85-4666-AC9E-4C30B10F5348@illinois.edu> <63F5396BCA044FB99AC6B543A52F2EA4@NewLife> Message-ID: <526B1ADC-411A-41BB-88A7-CE1C79F19E15@illinois.edu> The current preliminary BioC interface in biolib is actually a direct swig-based interface to the affyio C lib in BioC. It should be a much faster solution (i.e. you shouldn't have to go Perl<->R<->affyio, but Perl<->affyio). Pjotr has indicated more swig-based interfaces are possibly on the way. chris On Jan 7, 2009, at 9:32 AM, Dr. T. I. Simpson wrote: > I did use RSPerl but was deeply displeased with what was simply a > solution born of necessity at the time. It got the job done, but was > not a long term solution. I look likely to revisit the throny issue > in the next couple of months as I am trying to package up some > simple downstream clustering analysis code into a bioperl package. I > would dearly love to have it all nicely connected up to R, so am > keeping an eye on the some threads that are running on BioC/BioPerl > integration and the potential to use BioLib for this purpose http://biolib.open-bio.org/wiki/Main_Page > . I know painfully little about this at the moment, but plan to gen > up in the coming weeks. > > Ian. > > On Wed, 07 Jan 2009 15:19:44 -0000, Mark A. Jensen > wrote: > >> What solution did you responders wind up using? Do people generally >> get RSPerl to work and wash their hands of it afterwards? Or do you >> finally hand-code a good deal? thx >> ----- Original Message ----- From: "Dr. T. I. Simpson" > > >> To: "Chris Fields" ; "Boris Umylny" > > >> Cc: >> Sent: Wednesday, January 07, 2009 9:55 AM >> Subject: Re: [Bioperl-l] The Power of R >> >> >>> I agree with Chris on this. >>> >>> Used RSPerl about a year ago to integrate some clustering >>> experiments in R with a Perl script that fed data to R and picked >>> up output, but it was mighty painful and accessing R objects >>> through RSPerl was indeed a PITA. >>> >>> Ian. >>> >>> >>> On Wed, 07 Jan 2009 13:26:14 -0000, Chris Fields >> > wrote: >>> >>>> Not to bash this, as it is a decent piece of software, but... : > >>>> >>>> 1) Painful to install, and doesn't support a local perl >>>> installation (keeps attempting to go back and use my 5.8.8 >>>> instead of my local 5.10). >>>> 2) Not on CPAN. >>>> 3) Though this is supposed to be bidirectional, R from Perl is >>>> not well supported and apparently does not work for Windows. >>>> 4) Doesn't appear to be well-supported in general. >>>> >>>> I do not intend on writing a full perl suite for R/BioC analyses >>>> if I end up having to work around problems with the critical >>>> module. >>>> >>>> -c >>>> >>>> On Jan 6, 2009, at 11:34 PM, Boris Umylny wrote: >>>> >>>>> What do you think of RSPerl (http://www.omegahat.org/RSPerl/)? >>>>> >>>>> >>>>> Boris >>>>> >>>>> >>>>> ----- Original Message ----- From: "Chris Fields" >>>> > >>>>> To: "Mark A. Jensen" >>>>> Cc: >>>>> Sent: Wednesday, January 07, 2009 2:04 PM >>>>> Subject: Re: [Bioperl-l] The Power of R >>>>> >>>>> >>>>>> Now if we can only get a decent Perl-R interface which isn't a >>>>>> PITA to install... >>>>>> >>>>>> chris >>>>>> >>>>>> On Jan 6, 2009, at 9:33 PM, Mark A. Jensen wrote: >>>>>> >>>>>>> So says the New York Times: >>>>>>> http://www.nytimes.com/2009/01/07/technology/business-computing/07program.html >>>>>>> >>>>>>> _______________________________________________ >>>>>>> Bioperl-l mailing list >>>>>>> Bioperl-l at lists.open-bio.org >>>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>>>> >>>>>> _______________________________________________ >>>>>> Bioperl-l mailing list >>>>>> Bioperl-l at lists.open-bio.org >>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>>> >>>> >>>> _______________________________________________ >>>> Bioperl-l mailing list >>>> Bioperl-l at lists.open-bio.org >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>> >>> >>> >>> >>> -- Dr T. I. Simpson >>> School of Biomedical Sciences >>> University of Edinburgh >>> Hugh Robson Building >>> George Square >>> Edinburgh >>> EH8 9XD >>> >>> ian.simpson at ed.ac.uk >>> >>> >>> The University of Edinburgh is a charitable body, registered in >>> Scotland, with registration number SC005336. >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>> >>> >> >> > > > > -- > Dr T. I. Simpson > School of Biomedical Sciences > University of Edinburgh > Hugh Robson Building > George Square > Edinburgh > EH8 9XD > > ian.simpson at ed.ac.uk > > > The University of Edinburgh is a charitable body, registered in > Scotland, with registration number SC005336. From awitney at sgul.ac.uk Wed Jan 7 10:45:28 2009 From: awitney at sgul.ac.uk (Adam Witney) Date: Wed, 7 Jan 2009 15:45:28 +0000 Subject: [Bioperl-l] The Power of R In-Reply-To: <63F5396BCA044FB99AC6B543A52F2EA4@NewLife> References: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife><56AC3EAA-715D-4E0B-928C-37FAE78C1DDF@illinois.edu><0C22B476CF534F60933CCA206D62C81F@UmylnyLaptop><5898CC7F-1A85-4666-AC9E-4C30B10F5348@illinois.edu> <63F5396BCA044FB99AC6B543A52F2EA4@NewLife> Message-ID: <8912C5CD-2FB3-4AB1-BA32-488C49C0552B@sgul.ac.uk> We use it for one small, fairly simple application which was written by an MSc project student so allowed her to use Perl and R in her project. It was a bit of a pain to get up and running, but does the job and so is still in use. I'm not sure i would use it for anything more complicated though. adam On 7 Jan 2009, at 15:19, Mark A. Jensen wrote: > What solution did you responders wind up using? Do people generally > get RSPerl to work and wash their hands of it afterwards? Or do you > finally hand-code a good deal? thx > ----- Original Message ----- From: "Dr. T. I. Simpson" > > To: "Chris Fields" ; "Boris Umylny" > > Cc: > Sent: Wednesday, January 07, 2009 9:55 AM > Subject: Re: [Bioperl-l] The Power of R > > >> I agree with Chris on this. >> >> Used RSPerl about a year ago to integrate some clustering >> experiments in R with a Perl script that fed data to R and picked >> up output, but it was mighty painful and accessing R objects >> through RSPerl was indeed a PITA. >> >> Ian. >> >> >> On Wed, 07 Jan 2009 13:26:14 -0000, Chris Fields > > wrote: >> >>> Not to bash this, as it is a decent piece of software, but... : > >>> >>> 1) Painful to install, and doesn't support a local perl >>> installation (keeps attempting to go back and use my 5.8.8 >>> instead of my local 5.10). >>> 2) Not on CPAN. >>> 3) Though this is supposed to be bidirectional, R from Perl is not >>> well supported and apparently does not work for Windows. >>> 4) Doesn't appear to be well-supported in general. >>> >>> I do not intend on writing a full perl suite for R/BioC analyses >>> if I end up having to work around problems with the critical >>> module. >>> >>> -c >>> >>> On Jan 6, 2009, at 11:34 PM, Boris Umylny wrote: >>> >>>> What do you think of RSPerl (http://www.omegahat.org/RSPerl/)? >>>> >>>> >>>> Boris >>>> >>>> >>>> ----- Original Message ----- From: "Chris Fields" >>> > >>>> To: "Mark A. Jensen" >>>> Cc: >>>> Sent: Wednesday, January 07, 2009 2:04 PM >>>> Subject: Re: [Bioperl-l] The Power of R >>>> >>>> >>>>> Now if we can only get a decent Perl-R interface which isn't a >>>>> PITA to install... >>>>> >>>>> chris >>>>> >>>>> On Jan 6, 2009, at 9:33 PM, Mark A. Jensen wrote: >>>>> >>>>>> So says the New York Times: >>>>>> http://www.nytimes.com/2009/01/07/technology/business-computing/07program.html >>>>>> >>>>>> _______________________________________________ >>>>>> Bioperl-l mailing list >>>>>> Bioperl-l at lists.open-bio.org >>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>>> >>>>> _______________________________________________ >>>>> Bioperl-l mailing list >>>>> Bioperl-l at lists.open-bio.org >>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>> >>> >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>> >> >> >> >> -- >> Dr T. I. Simpson >> School of Biomedical Sciences >> University of Edinburgh >> Hugh Robson Building >> George Square >> Edinburgh >> EH8 9XD >> >> ian.simpson at ed.ac.uk >> >> >> The University of Edinburgh is a charitable body, registered in >> Scotland, with registration number SC005336. >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From sdavis2 at mail.nih.gov Wed Jan 7 12:41:22 2009 From: sdavis2 at mail.nih.gov (Sean Davis) Date: Wed, 7 Jan 2009 12:41:22 -0500 Subject: [Bioperl-l] The Power of R In-Reply-To: <526B1ADC-411A-41BB-88A7-CE1C79F19E15@illinois.edu> References: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife> <56AC3EAA-715D-4E0B-928C-37FAE78C1DDF@illinois.edu> <0C22B476CF534F60933CCA206D62C81F@UmylnyLaptop> <5898CC7F-1A85-4666-AC9E-4C30B10F5348@illinois.edu> <63F5396BCA044FB99AC6B543A52F2EA4@NewLife> <526B1ADC-411A-41BB-88A7-CE1C79F19E15@illinois.edu> Message-ID: <264855a00901070941t39ebb8e5m2d4aec66091cde84@mail.gmail.com> On Wed, Jan 7, 2009 at 10:58 AM, Chris Fields wrote: > The current preliminary BioC interface in biolib is actually a direct > swig-based interface to the affyio C lib in BioC. It should be a much > faster solution (i.e. you shouldn't have to go Perl<->R<->affyio, but > Perl<->affyio). Pjotr has indicated more swig-based interfaces are possibly > on the way. If affy is what you are after, Affy has their SDK that could potentially be used directly, though I haven't tried this myself. Sean > > > On Jan 7, 2009, at 9:32 AM, Dr. T. I. Simpson wrote: > > I did use RSPerl but was deeply displeased with what was simply a solution >> born of necessity at the time. It got the job done, but was not a long term >> solution. I look likely to revisit the throny issue in the next couple of >> months as I am trying to package up some simple downstream clustering >> analysis code into a bioperl package. I would dearly love to have it all >> nicely connected up to R, so am keeping an eye on the some threads that are >> running on BioC/BioPerl integration and the potential to use BioLib for this >> purpose http://biolib.open-bio.org/wiki/Main_Page. I know painfully >> little about this at the moment, but plan to gen up in the coming weeks. >> >> Ian. >> >> On Wed, 07 Jan 2009 15:19:44 -0000, Mark A. Jensen >> wrote: >> >> What solution did you responders wind up using? Do people generally get >>> RSPerl to work and wash their hands of it afterwards? Or do you finally >>> hand-code a good deal? thx >>> ----- Original Message ----- From: "Dr. T. I. Simpson" < >>> ian.simpson at ed.ac.uk> >>> To: "Chris Fields" ; "Boris Umylny" < >>> umylny at apbri.org> >>> Cc: >>> Sent: Wednesday, January 07, 2009 9:55 AM >>> Subject: Re: [Bioperl-l] The Power of R >>> >>> >>> I agree with Chris on this. >>>> >>>> Used RSPerl about a year ago to integrate some clustering experiments in >>>> R with a Perl script that fed data to R and picked up output, but it was >>>> mighty painful and accessing R objects through RSPerl was indeed a PITA. >>>> >>>> Ian. >>>> >>>> >>>> On Wed, 07 Jan 2009 13:26:14 -0000, Chris Fields >>>> wrote: >>>> >>>> Not to bash this, as it is a decent piece of software, but... : > >>>>> >>>>> 1) Painful to install, and doesn't support a local perl installation >>>>> (keeps attempting to go back and use my 5.8.8 instead of my local 5.10). >>>>> 2) Not on CPAN. >>>>> 3) Though this is supposed to be bidirectional, R from Perl is not well >>>>> supported and apparently does not work for Windows. >>>>> 4) Doesn't appear to be well-supported in general. >>>>> >>>>> I do not intend on writing a full perl suite for R/BioC analyses if I >>>>> end up having to work around problems with the critical module. >>>>> >>>>> -c >>>>> >>>>> On Jan 6, 2009, at 11:34 PM, Boris Umylny wrote: >>>>> >>>>> What do you think of RSPerl (http://www.omegahat.org/RSPerl/)? >>>>>> >>>>>> >>>>>> Boris >>>>>> >>>>>> >>>>>> ----- Original Message ----- From: "Chris Fields" < >>>>>> cjfields at illinois.edu >>>>>> > >>>>>> To: "Mark A. Jensen" >>>>>> Cc: >>>>>> Sent: Wednesday, January 07, 2009 2:04 PM >>>>>> Subject: Re: [Bioperl-l] The Power of R >>>>>> >>>>>> >>>>>> Now if we can only get a decent Perl-R interface which isn't a PITA >>>>>>> to install... >>>>>>> >>>>>>> chris >>>>>>> >>>>>>> On Jan 6, 2009, at 9:33 PM, Mark A. Jensen wrote: >>>>>>> >>>>>>> So says the New York Times: >>>>>>>> >>>>>>>> http://www.nytimes.com/2009/01/07/technology/business-computing/07program.html >>>>>>>> >>>>>>>> _______________________________________________ >>>>>>>> Bioperl-l mailing list >>>>>>>> Bioperl-l at lists.open-bio.org >>>>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>>>>>> >>>>>>> >>>>>>> _______________________________________________ >>>>>>> Bioperl-l mailing list >>>>>>> Bioperl-l at lists.open-bio.org >>>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>>>>> >>>>>> >>>>>> >>>>> _______________________________________________ >>>>> Bioperl-l mailing list >>>>> Bioperl-l at lists.open-bio.org >>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>>> >>>>> >>>> >>>> >>>> -- Dr T. I. Simpson >>>> School of Biomedical Sciences >>>> University of Edinburgh >>>> Hugh Robson Building >>>> George Square >>>> Edinburgh >>>> EH8 9XD >>>> >>>> ian.simpson at ed.ac.uk >>>> >>>> >>>> The University of Edinburgh is a charitable body, registered in >>>> Scotland, with registration number SC005336. >>>> _______________________________________________ >>>> Bioperl-l mailing list >>>> Bioperl-l at lists.open-bio.org >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>> >>>> >>>> >>> >>> >> >> >> -- >> Dr T. I. Simpson >> School of Biomedical Sciences >> University of Edinburgh >> Hugh Robson Building >> George Square >> Edinburgh >> EH8 9XD >> >> ian.simpson at ed.ac.uk >> >> >> The University of Edinburgh is a charitable body, registered in >> Scotland, with registration number SC005336. >> > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > From valiente at lsi.upc.edu Wed Jan 7 13:04:32 2009 From: valiente at lsi.upc.edu (Gabriel Valiente) Date: Wed, 7 Jan 2009 19:04:32 +0100 Subject: [Bioperl-l] The Power of R (Chris Fields) In-Reply-To: References: Message-ID: <126CE607-0FB4-4C50-82F8-D9608BE7C3A7@lsi.upc.edu> >> While we're on the topic, can anyone recommend a good book or >> resource from which to learn R, to supplement the official docs? If you can wait just a couple of months, my new book G. Valiente. Combinatorial Pattern Matching Algorithms in Computational Biology using Perl and R. Taylor & Francis/CRC Press (2009) http://www.crcpress.co.uk/shopping_cart/products/product_detail.asp? isbn=9781420069730 is already in press and will be available from Francis & Taylor in April. being the author, I'm certainly not the right person to recommend it, but in my humble opinion, it will also be of much use to BioPerl developers and users. Gabriel From cjfields at illinois.edu Wed Jan 7 13:44:02 2009 From: cjfields at illinois.edu (Chris Fields) Date: Wed, 7 Jan 2009 12:44:02 -0600 Subject: [Bioperl-l] The Power of R (Chris Fields) In-Reply-To: <126CE607-0FB4-4C50-82F8-D9608BE7C3A7@lsi.upc.edu> References: <126CE607-0FB4-4C50-82F8-D9608BE7C3A7@lsi.upc.edu> Message-ID: Perfect! I'll keep an eye out for it. -c On Jan 7, 2009, at 12:04 PM, Gabriel Valiente wrote: >>> While we're on the topic, can anyone recommend a good book or >>> resource from which to learn R, to supplement the official docs? > > If you can wait just a couple of months, my new book > > G. Valiente. Combinatorial Pattern Matching Algorithms in > Computational Biology using Perl and R. Taylor & Francis/CRC Press > (2009) > > http://www.crcpress.co.uk/shopping_cart/products/product_detail.asp?isbn=9781420069730 > > is already in press and will be available from Francis & Taylor in > April. being the author, I'm certainly not the right person to > recommend it, but in my humble opinion, it will also be of much use > to BioPerl developers and users. > > Gabriel > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From cjfields at illinois.edu Wed Jan 7 13:53:09 2009 From: cjfields at illinois.edu (Chris Fields) Date: Wed, 7 Jan 2009 12:53:09 -0600 Subject: [Bioperl-l] [ANNOUCEMENT] BioPerl 1.6 RC2 In-Reply-To: <461D1DC4-F522-47EA-B4FB-982B9F80013C@illinois.edu> References: <461D1DC4-F522-47EA-B4FB-982B9F80013C@illinois.edu> Message-ID: <1868E0F5-E057-4961-9A10-9BA94B00BFEB@illinois.edu> No copy-and-paste errors there. Nope, none at all. ;P -c On Jan 6, 2009, at 5:23 PM, Chris Fields wrote: > All, > > All, > > I am like to announce the second release candidate for BioPerl 1.6 > is available for testing. > > A quick note on versioning: due to issues with alpha numbered > versions on CPAN possibly overwriting a stable release, this release > candidate has a VERSION of 1.005009_002 (or 1.005009002). This will > be switched to 1.006000 (no alpha) once the release is final. > > The RC is currently being uploaded to CPAN and should be available > in the next 24-48 hours under authorname CJFIELDS. In the meantime, > the release candidates can be directly downloaded here: > > http://bioperl.org/DIST/BioPerl-1.5.9_2.tar.bz2 > http://bioperl.org/DIST/BioPerl-1.5.9_2.tar.gz > http://bioperl.org/DIST/BioPerl-1.5.9_2.zip > > Signature file: > http://bioperl.org/DIST/SIGNATURES.md5 > > A preliminary ActiveState PPM is also available and is located in > the BioPerl Release Candidate repository; the directions for > installation are here: > > http://www.bioperl.org/wiki/Installing_Bioperl_on_Windows > > Please feel free to report issues with testing, installation, etc. > on the mail list and on this page: > > http://www.bioperl.org/wiki/Release_1.6_Testing > > Again, just to note we will be releasing bioperl-run, bioperl-db, > bioperl-network, and others separately once the final 1.6 release is > complete. > > Since the last release: > > Fixed: > > 1) Some cruft from testing the last release is no longer present. > 2) Several warnings and test failures (via CPAN Testers) now fixed. > > Known Issues: > > 1) A very recent change in ENSembl data causes one of the Map.t > tests to fail; this has already been fixed and will be present in > the next (final?) release. > 2) Some odd warnings for Bio::Assembly tests are still present, but > they are harmless. Nevertheless they will be addressed prior to the > next release. > 3) Warnings for Bio::Annotation tests can be fixed by an upgrade to > the latest Data::Stag (this is NOT a required upgrade). > 4) PPM issues; note this is not high on our priority list ATM but I > will try to address it for the next release). > > Enjoy! > > chris > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From David.Messina at sbc.su.se Wed Jan 7 18:24:33 2009 From: David.Messina at sbc.su.se (Dave Messina) Date: Thu, 8 Jan 2009 00:24:33 +0100 Subject: [Bioperl-l] The Power of R (Chris Fields) In-Reply-To: References: <126CE607-0FB4-4C50-82F8-D9608BE7C3A7@lsi.upc.edu> Message-ID: <628aabb70901071524j2a20310aj99634e28eba7d05@mail.gmail.com> Thanks Gabriel -- sounds great! Dave From Russell.Smithies at agresearch.co.nz Wed Jan 7 19:33:26 2009 From: Russell.Smithies at agresearch.co.nz (Smithies, Russell) Date: Thu, 8 Jan 2009 13:33:26 +1300 Subject: [Bioperl-l] assembling chromosomes from contigs and .agp file In-Reply-To: <628aabb70901071524j2a20310aj99634e28eba7d05@mail.gmail.com> References: <126CE607-0FB4-4C50-82F8-D9608BE7C3A7@lsi.upc.edu> <628aabb70901071524j2a20310aj99634e28eba7d05@mail.gmail.com> Message-ID: <18DF7D20DFEC044098A1062202F5FFF31A6952402A@exchsth.agresearch.co.nz> Does anyone have a script for building chromosomes from an .agp file and a directory full of contigs? If not, I'll write something but I didn't want to re-invent the wheel if there's something "in the wild". Would something like a Bio::Assembly::IO::agp.pm be a good idea? Could an .agp file be regarded as a Bio::Assembly? --Russell ======================================================================= Attention: The information contained in this message and/or attachments from AgResearch Limited is intended only for the persons or entities to which it is addressed and may contain confidential and/or privileged material. Any review, retransmission, dissemination or other use of, or taking of any action in reliance upon, this information by persons or entities other than the intended recipients is prohibited by AgResearch Limited. If you have received this message in error, please notify the sender immediately. ======================================================================= From abhishek.vit at gmail.com Wed Jan 7 21:50:51 2009 From: abhishek.vit at gmail.com (Abhishek Pratap) Date: Wed, 7 Jan 2009 21:50:51 -0500 Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl In-Reply-To: <52cea20c0901062157j5bb98540uac2c719bb172212a@mail.gmail.com> References: <18DF7D20DFEC044098A1062202F5FFF31A69523F20@exchsth.agresearch.co.nz> <52cea20c0901061513x593acb44o641b87e35b8ff6fe@mail.gmail.com> <835D79AC-0D2A-40BE-87F1-0591F69C036A@illinois.edu> <52cea20c0901062157j5bb98540uac2c719bb172212a@mail.gmail.com> Message-ID: Thanks Joshua. I will use it and get back to you if we have any questions here. Best, -Abhi On Wed, Jan 7, 2009 at 12:57 AM, Joshua Udall wrote: > Done. Let me know if you have any questions. Here's the comments I > included with the submission (plus a few additions): > > Attached is code to facilitate ace file IO - particularly of large ace > files. The code will read ace contig entries one-at-a-time, instead of all > at once in the following manner: > $contig = stream->next_contig > > It will write ace files to a text file using: > $stream->write_contig($contig) > > General Usage: > my $contig_io = > Bio::Assembly::ContigIO->new(-file=>$ace_filename,-format=>'ace'); > while (defined (my $contig = $contig_io->next_contig() ) ) > { > # do something here. > } > > The general usage above should be familiar to those using bioperl. It is > obviously different than the AssemblyIO which also uses a '->next' stream > and an ace.pm file (in the IO dir). I found that very confusing because I > haven't often had multiple assemblies that I need to parse and it seems like > overkill. > > The main files are ContigIO.pm and the ace.pm in the ContigIO dir. I've > attached other files that are in the bundle too. We did this some time ago > and though the files have the same author info at the top, we've made a few > changes to them. > > A several months ago, I found that the recently discussed LocatableSeq bug > was causing problems for me with this code. Not imagining that I could have > actually found a bioperl bug myself, I made my own simple workaround by > adjusting the 'end' value. If the LocatableSeq bug has been fixed, this > module should work fine. I'm simply commenting that it is untested with > 1.6. > > I've also attached the files submitted to bugzilla to this message as per > Abhichek's request. Good luck. > > Josh > > > > > On Tue, Jan 6, 2009 at 3:22 PM, Chris Fields wrote: > >> Could you archive the files and attach them to a bug report (you can mark >> it as an enhancement request). We can take a look. >> >> http://bugzilla.open-bio.org/ >> >> chris >> >> >> On Jan 6, 2009, at 5:13 PM, Joshua Udall wrote: >> >> Chris et al. - >>> >>> A student and I have written code to do this - write ace files as well as >>> parse them one entry at a time. In trying to use the Assembly::IO as it >>> was >>> in 1.5, we ran into problems with large ace files containing many entries >>> because of file handle limit issues with the inherited implementation >>> DB_File. Our implementation simply reads one contig at a time instead of >>> first trying to slurp the whole ace into memory. I'm happy to add it to >>> Bioperl, but I am not sure how to do it. If I sent *.pm files to >>> someone, >>> could they help me get it into bioperl? It may not be perfect either, >>> but >>> it should be a good start. >>> >>> Josh >>> >>> On Tue, Jan 6, 2009 at 1:52 PM, Chris Fields >>> wrote: >>> >>> Not at this time (write_assembly is not implemented). If you come up >>>> with >>>> code to do so let us know (patches are always welcome). >>>> >>>> chris >>>> >>>> >>>> On Jan 6, 2009, at 2:43 PM, Abhishek Pratap wrote: >>>> >>>> Thanks that helped. >>>> >>>>> >>>>> Any method to write Ace files ? >>>>> >>>>> Thanks, >>>>> -Abhi >>>>> >>>>> On Tue, Jan 6, 2009 at 3:36 PM, Smithies, Russell < >>>>> Russell.Smithies at agresearch.co.nz> wrote: >>>>> >>>>> Here's how I've been doing it: >>>>> >>>>>> >>>>>> >>>>>> my $infile = "454Contigs.ace"; >>>>>> my $parser = new Bio::Assembly::IO(-file => $infile ,-format => >>>>>> "ace") >>>>>> or >>>>>> die $!; >>>>>> my $assembly = $parser->next_assembly; >>>>>> >>>>>> # to work with a named contig >>>>>> my @wanted_id = ("Contig100"); >>>>>> my ($contig) = $assembly->select_contigs(@wanted_id) or die $!; >>>>>> >>>>>> #get the consensus >>>>>> my $consensus = $contig->get_consensus_sequence(); >>>>>> >>>>>> #get the consensus qualities >>>>>> my @quality_values = @{$contig->get_consensus_quality()->qual()}; >>>>>> >>>>>> hope this helps, >>>>>> >>>>>> Russell >>>>>> >>>>>> >>>>>> -----Original Message----- >>>>>> >>>>>>> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l- >>>>>>> bounces at lists.open-bio.org] On Behalf Of Abhishek Pratap >>>>>>> Sent: Tuesday, 6 January 2009 6:43 p.m. >>>>>>> To: bioperl-l at lists.open-bio.org >>>>>>> Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl >>>>>>> >>>>>>> Hi All >>>>>>> >>>>>>> I am looking for some code to parse the ACE file format. I have big >>>>>>> ACE >>>>>>> files which I would like to trim based on the user defined Contig >>>>>>> name >>>>>>> and >>>>>>> specific region and write out the output to another fresh ACE file. >>>>>>> >>>>>>> For now I am trying to tweak Bio::Assembly::IO; but it is kind of >>>>>>> slow. >>>>>>> Any >>>>>>> other alternative or suggestions. >>>>>>> >>>>>>> Thanks All, >>>>>>> -Abhi >>>>>>> >>>>>>> >>>>>>> >>>>>>> >>>>>>> >>>>>>> >>>>>>> >>>>>>> >>>>>>> -- >>>>>>> ----------------------------- >>>>>>> Abhishek Pratap >>>>>>> Bioinformatics Software Engineer >>>>>>> Institute for Genome Sciences >>>>>>> School of Medicine, Univ of Maryland >>>>>>> 801, W. Baltimore Street, Baltimore, MD 21209 >>>>>>> Ph: (+1)-410-706-2296 >>>>>>> www.igs.umaryland.edu/ >>>>>>> >>>>>>> Chair >>>>>>> RSG-Worldwide >>>>>>> ISCB-Student Council >>>>>>> http://iscbsc.org/rsg >>>>>>> >>>>>>> www.bioinfosolutions.com >>>>>>> _______________________________________________ >>>>>>> Bioperl-l mailing list >>>>>>> Bioperl-l at lists.open-bio.org >>>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>>>>> >>>>>>> ======================================================================= >>>>>> Attention: The information contained in this message and/or >>>>>> attachments >>>>>> from AgResearch Limited is intended only for the persons or entities >>>>>> to which it is addressed and may contain confidential and/or >>>>>> privileged >>>>>> material. Any review, retransmission, dissemination or other use of, >>>>>> or >>>>>> taking of any action in reliance upon, this information by persons or >>>>>> entities other than the intended recipients is prohibited by >>>>>> AgResearch >>>>>> Limited. If you have received this message in error, please notify the >>>>>> sender immediately. >>>>>> >>>>>> ======================================================================= >>>>>> >>>>>> >>>>>> >>>>> >>>>> -- >>>>> ----------------------------- >>>>> Abhishek Pratap >>>>> Bioinformatics Software Engineer >>>>> Institute for Genome Sciences >>>>> School of Medicine, Univ of Maryland >>>>> 801, W. Baltimore Street, Baltimore, MD 21209 >>>>> Ph: (+1)-410-706-2296 >>>>> www.igs.umaryland.edu/ >>>>> >>>>> Chair >>>>> RSG-Worldwide >>>>> ISCB-Student Council >>>>> http://iscbsc.org/rsg >>>>> >>>>> www.bioinfosolutions.com >>>>> _______________________________________________ >>>>> Bioperl-l mailing list >>>>> Bioperl-l at lists.open-bio.org >>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>>> >>>>> >>>> _______________________________________________ >>>> Bioperl-l mailing list >>>> Bioperl-l at lists.open-bio.org >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>> >>>> >>> >>> >>> -- >>> Joshua Udall >>> Assistant Professor >>> 295 WIDB >>> Plant and Wildlife Science Dept. >>> Brigham Young University >>> Provo, UT 84602 >>> 801-422-9307 >>> Fax: 801-422-0008 >>> USA >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>> >> >> > > > -- > Joshua Udall > Assistant Professor > 295 WIDB > Plant and Wildlife Science Dept. > Brigham Young University > Provo, UT 84602 > 801-422-9307 > Fax: 801-422-0008 > USA > -- ----------------------------- Abhishek Pratap Bioinformatics Software Engineer Institute for Genome Sciences School of Medicine, Univ of Maryland 801, W. Baltimore Street, Baltimore, MD 21209 Ph: (+1)-410-706-2296 www.igs.umaryland.edu/ Chair RSG-Worldwide ISCB-Student Council http://iscbsc.org/rsg www.bioinfosolutions.com From maj at fortinbras.us Wed Jan 7 22:11:13 2009 From: maj at fortinbras.us (Mark A. Jensen) Date: Wed, 7 Jan 2009 22:11:13 -0500 Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl In-Reply-To: References: <18DF7D20DFEC044098A1062202F5FFF31A69523F20@exchsth.agresearch.co.nz><52cea20c0901061513x593acb44o641b87e35b8ff6fe@mail.gmail.com><835D79AC-0D2A-40BE-87F1-0591F69C036A@illinois.edu><52cea20c0901062157j5bb98540uac2c719bb172212a@mail.gmail.com> Message-ID: <20F7D3BF791A4EC0958D4BC7CE301EF3@NewLife> Abhi/Josh- Please give me a shout if LocatableSeq gives you any throws or if you get strange coordinates. We're hoping it's well-fixed, but... thanks-Mark ----- Original Message ----- From: "Abhishek Pratap" To: "Joshua Udall" Cc: "Chris Fields" ; ; "Smithies, Russell" Sent: Wednesday, January 07, 2009 9:50 PM Subject: Re: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl > Thanks Joshua. > I will use it and get back to you if we have any questions here. > > Best, > -Abhi > > On Wed, Jan 7, 2009 at 12:57 AM, Joshua Udall wrote: > >> Done. Let me know if you have any questions. Here's the comments I >> included with the submission (plus a few additions): >> >> Attached is code to facilitate ace file IO - particularly of large ace >> files. The code will read ace contig entries one-at-a-time, instead of all >> at once in the following manner: >> $contig = stream->next_contig >> >> It will write ace files to a text file using: >> $stream->write_contig($contig) >> >> General Usage: >> my $contig_io = >> Bio::Assembly::ContigIO->new(-file=>$ace_filename,-format=>'ace'); >> while (defined (my $contig = $contig_io->next_contig() ) ) >> { >> # do something here. >> } >> >> The general usage above should be familiar to those using bioperl. It is >> obviously different than the AssemblyIO which also uses a '->next' stream >> and an ace.pm file (in the IO dir). I found that very confusing because I >> haven't often had multiple assemblies that I need to parse and it seems like >> overkill. >> >> The main files are ContigIO.pm and the ace.pm in the ContigIO dir. I've >> attached other files that are in the bundle too. We did this some time ago >> and though the files have the same author info at the top, we've made a few >> changes to them. >> >> A several months ago, I found that the recently discussed LocatableSeq bug >> was causing problems for me with this code. Not imagining that I could have >> actually found a bioperl bug myself, I made my own simple workaround by >> adjusting the 'end' value. If the LocatableSeq bug has been fixed, this >> module should work fine. I'm simply commenting that it is untested with >> 1.6. >> >> I've also attached the files submitted to bugzilla to this message as per >> Abhichek's request. Good luck. >> >> Josh >> >> >> >> >> On Tue, Jan 6, 2009 at 3:22 PM, Chris Fields wrote: >> >>> Could you archive the files and attach them to a bug report (you can mark >>> it as an enhancement request). We can take a look. >>> >>> http://bugzilla.open-bio.org/ >>> >>> chris >>> >>> >>> On Jan 6, 2009, at 5:13 PM, Joshua Udall wrote: >>> >>> Chris et al. - >>>> >>>> A student and I have written code to do this - write ace files as well as >>>> parse them one entry at a time. In trying to use the Assembly::IO as it >>>> was >>>> in 1.5, we ran into problems with large ace files containing many entries >>>> because of file handle limit issues with the inherited implementation >>>> DB_File. Our implementation simply reads one contig at a time instead of >>>> first trying to slurp the whole ace into memory. I'm happy to add it to >>>> Bioperl, but I am not sure how to do it. If I sent *.pm files to >>>> someone, >>>> could they help me get it into bioperl? It may not be perfect either, >>>> but >>>> it should be a good start. >>>> >>>> Josh >>>> >>>> On Tue, Jan 6, 2009 at 1:52 PM, Chris Fields >>>> wrote: >>>> >>>> Not at this time (write_assembly is not implemented). If you come up >>>>> with >>>>> code to do so let us know (patches are always welcome). >>>>> >>>>> chris >>>>> >>>>> >>>>> On Jan 6, 2009, at 2:43 PM, Abhishek Pratap wrote: >>>>> >>>>> Thanks that helped. >>>>> >>>>>> >>>>>> Any method to write Ace files ? >>>>>> >>>>>> Thanks, >>>>>> -Abhi >>>>>> >>>>>> On Tue, Jan 6, 2009 at 3:36 PM, Smithies, Russell < >>>>>> Russell.Smithies at agresearch.co.nz> wrote: >>>>>> >>>>>> Here's how I've been doing it: >>>>>> >>>>>>> >>>>>>> >>>>>>> my $infile = "454Contigs.ace"; >>>>>>> my $parser = new Bio::Assembly::IO(-file => $infile ,-format => >>>>>>> "ace") >>>>>>> or >>>>>>> die $!; >>>>>>> my $assembly = $parser->next_assembly; >>>>>>> >>>>>>> # to work with a named contig >>>>>>> my @wanted_id = ("Contig100"); >>>>>>> my ($contig) = $assembly->select_contigs(@wanted_id) or die $!; >>>>>>> >>>>>>> #get the consensus >>>>>>> my $consensus = $contig->get_consensus_sequence(); >>>>>>> >>>>>>> #get the consensus qualities >>>>>>> my @quality_values = @{$contig->get_consensus_quality()->qual()}; >>>>>>> >>>>>>> hope this helps, >>>>>>> >>>>>>> Russell >>>>>>> >>>>>>> >>>>>>> -----Original Message----- >>>>>>> >>>>>>>> From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l- >>>>>>>> bounces at lists.open-bio.org] On Behalf Of Abhishek Pratap >>>>>>>> Sent: Tuesday, 6 January 2009 6:43 p.m. >>>>>>>> To: bioperl-l at lists.open-bio.org >>>>>>>> Subject: [Bioperl-l] Parser: Ace file (Sequence Assembly) in Bioperl >>>>>>>> >>>>>>>> Hi All >>>>>>>> >>>>>>>> I am looking for some code to parse the ACE file format. I have big >>>>>>>> ACE >>>>>>>> files which I would like to trim based on the user defined Contig >>>>>>>> name >>>>>>>> and >>>>>>>> specific region and write out the output to another fresh ACE file. >>>>>>>> >>>>>>>> For now I am trying to tweak Bio::Assembly::IO; but it is kind of >>>>>>>> slow. >>>>>>>> Any >>>>>>>> other alternative or suggestions. >>>>>>>> >>>>>>>> Thanks All, >>>>>>>> -Abhi >>>>>>>> >>>>>>>> >>>>>>>> >>>>>>>> >>>>>>>> >>>>>>>> >>>>>>>> >>>>>>>> >>>>>>>> -- >>>>>>>> ----------------------------- >>>>>>>> Abhishek Pratap >>>>>>>> Bioinformatics Software Engineer >>>>>>>> Institute for Genome Sciences >>>>>>>> School of Medicine, Univ of Maryland >>>>>>>> 801, W. Baltimore Street, Baltimore, MD 21209 >>>>>>>> Ph: (+1)-410-706-2296 >>>>>>>> www.igs.umaryland.edu/ >>>>>>>> >>>>>>>> Chair >>>>>>>> RSG-Worldwide >>>>>>>> ISCB-Student Council >>>>>>>> http://iscbsc.org/rsg >>>>>>>> >>>>>>>> www.bioinfosolutions.com >>>>>>>> _______________________________________________ >>>>>>>> Bioperl-l mailing list >>>>>>>> Bioperl-l at lists.open-bio.org >>>>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>>>>>> >>>>>>>> ======================================================================= >>>>>>> Attention: The information contained in this message and/or >>>>>>> attachments >>>>>>> from AgResearch Limited is intended only for the persons or entities >>>>>>> to which it is addressed and may contain confidential and/or >>>>>>> privileged >>>>>>> material. Any review, retransmission, dissemination or other use of, >>>>>>> or >>>>>>> taking of any action in reliance upon, this information by persons or >>>>>>> entities other than the intended recipients is prohibited by >>>>>>> AgResearch >>>>>>> Limited. If you have received this message in error, please notify the >>>>>>> sender immediately. >>>>>>> >>>>>>> ======================================================================= >>>>>>> >>>>>>> >>>>>>> >>>>>> >>>>>> -- >>>>>> ----------------------------- >>>>>> Abhishek Pratap >>>>>> Bioinformatics Software Engineer >>>>>> Institute for Genome Sciences >>>>>> School of Medicine, Univ of Maryland >>>>>> 801, W. Baltimore Street, Baltimore, MD 21209 >>>>>> Ph: (+1)-410-706-2296 >>>>>> www.igs.umaryland.edu/ >>>>>> >>>>>> Chair >>>>>> RSG-Worldwide >>>>>> ISCB-Student Council >>>>>> http://iscbsc.org/rsg >>>>>> >>>>>> www.bioinfosolutions.com >>>>>> _______________________________________________ >>>>>> Bioperl-l mailing list >>>>>> Bioperl-l at lists.open-bio.org >>>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>>>> >>>>>> >>>>> _______________________________________________ >>>>> Bioperl-l mailing list >>>>> Bioperl-l at lists.open-bio.org >>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>>> >>>>> >>>> >>>> >>>> -- >>>> Joshua Udall >>>> Assistant Professor >>>> 295 WIDB >>>> Plant and Wildlife Science Dept. >>>> Brigham Young University >>>> Provo, UT 84602 >>>> 801-422-9307 >>>> Fax: 801-422-0008 >>>> USA >>>> _______________________________________________ >>>> Bioperl-l mailing list >>>> Bioperl-l at lists.open-bio.org >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>> >>> >>> >> >> >> -- >> Joshua Udall >> Assistant Professor >> 295 WIDB >> Plant and Wildlife Science Dept. >> Brigham Young University >> Provo, UT 84602 >> 801-422-9307 >> Fax: 801-422-0008 >> USA >> > > > > -- > ----------------------------- > Abhishek Pratap > Bioinformatics Software Engineer > Institute for Genome Sciences > School of Medicine, Univ of Maryland > 801, W. Baltimore Street, Baltimore, MD 21209 > Ph: (+1)-410-706-2296 > www.igs.umaryland.edu/ > > Chair > RSG-Worldwide > ISCB-Student Council > http://iscbsc.org/rsg > > www.bioinfosolutions.com > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > From Russell.Smithies at agresearch.co.nz Wed Jan 7 22:59:08 2009 From: Russell.Smithies at agresearch.co.nz (Smithies, Russell) Date: Thu, 8 Jan 2009 16:59:08 +1300 Subject: [Bioperl-l] assembling chromosomes from contigs and .agp file In-Reply-To: <18DF7D20DFEC044098A1062202F5FFF31A69567DC7@exchsth.agresearch.co.nz> References: <126CE607-0FB4-4C50-82F8-D9608BE7C3A7@lsi.upc.edu> <628aabb70901071524j2a20310aj99634e28eba7d05@mail.gmail.com> <18DF7D20DFEC044098A1062202F5FFF31A69567DC7@exchsth.agresearch.co.nz> Message-ID: <18DF7D20DFEC044098A1062202F5FFF31A69524072@exchsth.agresearch.co.nz> Was easier than I thought although I couldn't work out a way to "build" a Bio::Seq directly from bits. Here's how I did it: ------------------------------- use Bio::DB::Fasta; use Bio::Seq; use Bio::SeqIO; open(AGP,"Mt2.0_pgp.agp") or die $!; my @chr = (); my $db = Bio::DB::Fasta->new("contigs.fa"); while(){ chomp; split /\s/; # extend temp string if it's too short do{$chr[$_[0]] .= ' ' x 1_000_000;}while length $chr[$_[0]] < $_[2] ; if($_[4] !~ m/N/){ ($start,$stop) = $_[8] eq '+'?($_[6], $_[7]):($_[7], $_[6]); $s = substr $chr[$_[0]], $_[1], $_[9], $db->seq($_[5],$start,$stop); }else{ $s = substr $chr[$_[0]], $_[1], $_[5], "N" x $_[5] ; } } #remove any trailing whitespace @chr = map{s/\s+//g;$_}@chr; #print the sequence. chromosomes are chr0 -> chr8 foreach(0..$#chr){ my $seqobj = Bio::Seq->new( -display_id => "chr$_", -seq => $chr[$_]); my $seq_out = Bio::SeqIO->new('-file' => ">chr$_.fa",'-format' => 'fasta'); $seq_out->write_seq($seqobj); } ------------------------------- Please excuse my hacky use of substrings but this .agp file had overlapping runs of 'N' and this was the easiest way to deal with it e.g. 0 1 50000 1 N 50000 clone yes 0 50001 167645 2 F AC144644.3 1 117645 + 117645 0 167646 217645 3 N 50000 clone yes 0 217646 317645 4 N 100000 contig no 0 317646 367645 5 N 50000 clone yes 0 367646 411754 6 F AC146805.17 1 44109 + 44109 --Russell > -----Original Message----- > From: Smithies, Russell > Sent: Thursday, 8 January 2009 1:33 p.m. > To: 'bioperl-l at lists.open-bio.org' > Subject: assembling chromosomes from contigs and .agp file > > Does anyone have a script for building chromosomes from an .agp file > and a directory full of contigs? > If not, I'll write something but I didn't want to re-invent the wheel > if there's something "in the wild". > > Would something like a Bio::Assembly::IO::agp.pm be a good idea? Could > an .agp file be regarded as a Bio::Assembly? > > --Russell > ======================================================================= Attention: The information contained in this message and/or attachments from AgResearch Limited is intended only for the persons or entities to which it is addressed and may contain confidential and/or privileged material. Any review, retransmission, dissemination or other use of, or taking of any action in reliance upon, this information by persons or entities other than the intended recipients is prohibited by AgResearch Limited. If you have received this message in error, please notify the sender immediately. ======================================================================= From jonathancrabtree at gmail.com Thu Jan 8 00:45:08 2009 From: jonathancrabtree at gmail.com (Jonathan Crabtree) Date: Thu, 8 Jan 2009 00:45:08 -0500 Subject: [Bioperl-l] The Power of R In-Reply-To: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife> References: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife> Message-ID: <8e5b8bf80901072145u82c9544x7317c3daef1ee498@mail.gmail.com> Slightly off-topic, but if anyone feels like karaoke after reading this thread, here you go: The power of R is a curious thing Make a Perl man weep, make a Python man sing Take a t-test a little too far More than a free thing that's the power of R Stats and regressions, if that's your scene Faster and smarter, it's a math nerd's dream Make bad data good make wrong data right Power of R keeps you coding at night You don't need money, just data frames Don't need SAS analytics to make those planes It's free and it's open and it plots some lines But you might just need jackknife That's the power of R That's the power of R First time you run it, it might make you sad Next time you run it it might make you mad But you'll be glad baby when you've found That's the power keeps arrays in bounds And it don't take money, just data frames Don't need SAS analytics to make those planes It's free and it's open it can plot you some lines But you might just need jackknife They say that all in R is there Yeah, but you don't care But you know what to do When it gets hold of you And with a little help from a LUG You feel the power of R You feel the power of R, can you feel it? And it don't take money, just data frames Don't need SAS analytics to make those planes Tougher than BASIC and easier than C You won't feel nothing till you feel You feel the power, just the power of R That's the power, that's the power of R You feel the power of R You feel the power of R Feel the power of R On Tue, Jan 6, 2009 at 10:33 PM, Mark A. Jensen wrote: > So says the New York Times: > http://www.nytimes.com/2009/01/07/technology/business-computing/07program.html > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > From maj at fortinbras.us Thu Jan 8 10:05:58 2009 From: maj at fortinbras.us (Mark A. Jensen) Date: Thu, 8 Jan 2009 10:05:58 -0500 Subject: [Bioperl-l] The Power of R In-Reply-To: <8e5b8bf80901072145u82c9544x7317c3daef1ee498@mail.gmail.com> References: <70A9113F8A89491A8C9E0E3274CF95F2@NewLife> <8e5b8bf80901072145u82c9544x7317c3daef1ee498@mail.gmail.com> Message-ID: Jonathan- B-b-b-bad, possibly to the bone...MAJ ----- Original Message ----- From: "Jonathan Crabtree" To: "Mark A. Jensen" Cc: Sent: Thursday, January 08, 2009 12:45 AM Subject: Re: [Bioperl-l] The Power of R > Slightly off-topic, but if anyone feels like karaoke after reading > this thread, here you go: > > The power of R is a curious thing > Make a Perl man weep, make a Python man sing > Take a t-test a little too far > More than a free thing that's the power of R > > Stats and regressions, if that's your scene > Faster and smarter, it's a math nerd's dream > Make bad data good make wrong data right > Power of R keeps you coding at night > > You don't need money, just data frames > Don't need SAS analytics to make those planes > It's free and it's open and it plots some lines > But you might just need jackknife > That's the power of R > That's the power of R > > First time you run it, it might make you sad > Next time you run it it might make you mad > But you'll be glad baby when you've found > That's the power keeps arrays in bounds > > And it don't take money, just data frames > Don't need SAS analytics to make those planes > It's free and it's open it can plot you some lines > But you might just need jackknife > > They say that all in R is there > Yeah, but you don't care > But you know what to do > When it gets hold of you > And with a little help from a LUG > You feel the power of R > You feel the power of R, can you feel it? > > And it don't take money, just data frames > Don't need SAS analytics to make those planes > Tougher than BASIC and easier than C > You won't feel nothing till you feel > You feel the power, just the power of R > That's the power, that's the power of R > You feel the power of R > You feel the power of R > Feel the power of R > > > On Tue, Jan 6, 2009 at 10:33 PM, Mark A. Jensen wrote: >> So says the New York Times: >> http://www.nytimes.com/2009/01/07/technology/business-computing/07program.html >> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > From jason at bioperl.org Thu Jan 8 12:58:16 2009 From: jason at bioperl.org (Jason Stajich) Date: Thu, 8 Jan 2009 09:58:16 -0800 Subject: [Bioperl-l] module Bio::TreeIO In-Reply-To: <4966383F.5080502@esat.kuleuven.be> References: <4966383F.5080502@esat.kuleuven.be> Message-ID: Hi Valerie - Please ask this on the mailing list it is better for everyone to hear and help with questions. You want to do this: my $treeout = Bio::TreeIO->new(-format => 'newick', -file => ">MYFILENAME.tre"); I guess we need to more clearly explain that the IO system in BioPerl for new people but it is the same idea for SeqIO, TreeIO, etc you specify a filename to write to just like you would when opening a filehandle in perl open($fh, ">OUTPUTNAME") or o::TreeIO->new(-format => 'newick', -file => ">MYFILENAME.nh"); Filenames and extensions are whatever you want them to be, no guessing of formats based on filename extensions. Presumably you have seen the HOWTO as well http://bioperl.org/wiki/HOWTO:Trees If there are things that are unclear we'd appreciate you make that know by commenting on the Discussion page that is linked to it (tabs at the top of the page). -jason On Jan 8, 2009, at 9:30 AM, valerie storms wrote: > Dear Jason, > > I would like to use the BioPerl modules to (1) construct a > phylogenetic tree from a distance matrix, (2) put this tree is the > Newick format > and (3) save this tree in an output file. > The first two steps (1,2) are fine by using > Bio::Tree::DistanceFactory and Bio::TreeIO! > But I have no idea how I can get my tree saved in an output file > instaed of printed to the mean stream?? > > Can you help me with this? > Many Thanks in advance! > > Best regards, > > Storms Valerie > Phd student > KULeuven Belgium > > > p.s. The code I use > > > #!/usr/bin/perl -w > > my $myDEBUG = 1; > use lib '/users/sista/vstorms/local/lib/perl5/'; > use Bio::Perl; > use Bio::Tree::DistanceFactory; > use Bio::TreeIO; > use Bio::Tools::Phylo::Phylip::ProtDist; > > my $outfile_protdist = '/users/sista/vstorms/LEGENDO/motif_detection/ > inputfiles/selection2/distance_matrix.txt'; > my $tree_file = '/users/sista/vstorms/LEGENDO/motif_detection/ > inputfiles/selection2/Tree.txt'; > if (-e $tree_file){ > my $rm = 'rm -f '.$tree_file; > system $rm; > } my $dist = Bio::Tools::Phylo::Phylip::ProtDist->new( > -file=>"$outfile_protdist", > -program=>"ProtDist"); > my $matrix = $dist->next_matrix; > my $dfactory = Bio::Tree::DistanceFactory->new(-method => 'NJ'); > my $treein = Bio::TreeIO->new(-format => 'newick'); > my $treeout = Bio::TreeIO->new( -format => 'newick', -file => > $tree_file); > my $tree = $dfactory->make_tree($matrix); > $treein->write_tree($tree); > $treeout->write_tree($tree); > > > Disclaimer: http://www.kuleuven.be/cwis/email_disclaimer.htm > Jason Stajich jason at bioperl.org From wesleyarthur at optusnet.com.au Fri Jan 9 03:11:15 2009 From: wesleyarthur at optusnet.com.au (Wesley Arthur) Date: Fri, 9 Jan 2009 17:11:15 +0900 Subject: [Bioperl-l] Failed Istallation Message-ID: ----- Original Message ----- From: "Chris Fields" To: "BioPerl List" Sent: Thursday, January 08, 2009 3:53 AM Subject: Re: [Bioperl-l] [ANNOUCEMENT] BioPerl 1.6 RC2 > No copy-and-paste errors there. Nope, none at all. ;P > > -c > > On Jan 6, 2009, at 5:23 PM, Chris Fields wrote: > >> All, >> >> All, >> >> I am like to announce the second release candidate for BioPerl 1.6 is >> available for testing. >> >> A quick note on versioning: due to issues with alpha numbered versions >> on CPAN possibly overwriting a stable release, this release candidate >> has a VERSION of 1.005009_002 (or 1.005009002). This will be switched >> to 1.006000 (no alpha) once the release is final. >> >> The RC is currently being uploaded to CPAN and should be available in >> the next 24-48 hours under authorname CJFIELDS. In the meantime, the >> release candidates can be directly downloaded here: >> >> http://bioperl.org/DIST/BioPerl-1.5.9_2.tar.bz2 >> http://bioperl.org/DIST/BioPerl-1.5.9_2.tar.gz >> http://bioperl.org/DIST/BioPerl-1.5.9_2.zip >> >> Signature file: >> http://bioperl.org/DIST/SIGNATURES.md5 >> >> A preliminary ActiveState PPM is also available and is located in the >> BioPerl Release Candidate repository; the directions for installation >> are here: >> >> http://www.bioperl.org/wiki/Installing_Bioperl_on_Windows >> >> Please feel free to report issues with testing, installation, etc. on >> the mail list and on this page: >> >> http://www.bioperl.org/wiki/Release_1.6_Testing >> >> Again, just to note we will be releasing bioperl-run, bioperl-db, >> bioperl-network, and others separately once the final 1.6 release is >> complete. >> >> Since the last release: >> >> Fixed: >> >> 1) Some cruft from testing the last release is no longer present. >> 2) Several warnings and test failures (via CPAN Testers) now fixed. >> >> Known Issues: >> >> 1) A very recent change in ENSembl data causes one of the Map.t tests to >> fail; this has already been fixed and will be present in the next >> (final?) release. >> 2) Some odd warnings for Bio::Assembly tests are still present, but they >> are harmless. Nevertheless they will be addressed prior to the next >> release. >> 3) Warnings for Bio::Annotation tests can be fixed by an upgrade to the >> latest Data::Stag (this is NOT a required upgrade). >> 4) PPM issues; note this is not high on our priority list ATM but I will >> try to address it for the next release). >> >> Enjoy! >> >> chris >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l Dear Chris, Thank you for the latest release of RC 1.5.9_2 with the ActiveState PPM. My attempt to download this has failed. I am using Windowas Vista and Activeperl 5.8.8.824. The status tab diplayed the following; Synchronizing Database ... Downloading ActiveState Package Repository packlist ... done Updating ActiveState Package Repository database ... done Downloading BioPerl-Regular Releases packlist ... not modified Downloading Kobes packlist ... not modified Downloading Bribes packlist ... done Updating Bribes database ... done Downloading tcool packlist ... done Updating tcool database ... done Downloading BioPerl-Release Candidates packlist ... done Updating BioPerl-Release Candidates database ... done Synchronizing Database done BioPerl marked for install BioPerl depends on Bundle-BioPerl-Core BioPerl depends on Math-Random BioPerl depends on Bio-ASN1-EntrezGene BioPerl depends on Data-Stag BioPerl depends on Algorithm-Munkres BioPerl depends on GraphViz BioPerl depends on XML-Writer BioPerl depends on Graph BioPerl depends on XML-DOM-XPath BioPerl depends on PostScript BioPerl depends on Spreadsheet-ParseExcel BioPerl depends on XML-SAX BioPerl depends on AcePerl BioPerl depends on Array-Compare BioPerl depends on Convert-Binary-C BioPerl depends on XML-Twig BioPerl depends on Set-Scalar BioPerl depends on libxml-perl BioPerl depends on XML-SAX-Writer BioPerl depends on Clone BioPerl depends on DB_File BioPerl depends on IPC-Run BioPerl depends on XML-DOM BioPerl depends on XML-XPathEngine BioPerl depends on IO-stringy BioPerl depends on OLE-Storage_Lite BioPerl depends on Ocsinventory-Agent BioPerl depends on Cache-Cache BioPerl depends on Text-Iconv BioPerl depends on XML-Filter-BufferText BioPerl depends on XML-NamespaceSupport BioPerl depends on XML-RegExp BioPerl depends on Error Synchronizing Database ... Downloading ActiveState Package Repository packlist ... not modified Synchronizing Database done BioPerl marked for install BioPerl depends on Bundle-BioPerl-Core BioPerl depends on Math-Random BioPerl depends on Bio-ASN1-EntrezGene BioPerl depends on Data-Stag BioPerl depends on Algorithm-Munkres BioPerl depends on GraphViz BioPerl depends on XML-Writer BioPerl depends on Graph BioPerl depends on XML-DOM-XPath BioPerl depends on PostScript BioPerl depends on Spreadsheet-ParseExcel BioPerl depends on XML-SAX BioPerl depends on AcePerl BioPerl depends on Array-Compare BioPerl depends on Convert-Binary-C BioPerl depends on XML-Twig BioPerl depends on Set-Scalar BioPerl depends on libxml-perl BioPerl depends on XML-SAX-Writer BioPerl depends on Clone BioPerl depends on DB_File BioPerl depends on IPC-Run BioPerl depends on XML-DOM BioPerl depends on XML-XPathEngine BioPerl depends on IO-stringy BioPerl depends on OLE-Storage_Lite BioPerl depends on Ocsinventory-Agent BioPerl depends on Cache-Cache BioPerl depends on Text-Iconv BioPerl depends on XML-Filter-BufferText BioPerl depends on XML-NamespaceSupport BioPerl depends on XML-RegExp BioPerl depends on Error Installing 34 packages ... Downloading BioPerl-1.5.9_2 ... done Downloading Bundle-BioPerl-Core-1.5.9_2 ... done Downloading Math-Random-0.71 ... done Downloading Bio-ASN1-EntrezGene-1.09 ... done Downloading Data-Stag-0.11 ... done Downloading Algorithm-Munkres-0.08 ... done Downloading GraphViz-2.03 ... done Downloading XML-Writer-0.606 ... done Downloading Graph-0.90 ... done Downloading XML-DOM-XPath-0.14 ... done Downloading PostScript-0.06 ... done Downloading Spreadsheet-ParseExcel-0.43 ... done Downloading XML-SAX-0.96 ... done Downloading AcePerl-1.92 ... done Downloading Array-Compare-1.17 ... done Downloading Convert-Binary-C-0.71 ... done Downloading XML-Twig-3.32 ... done Downloading Set-Scalar-1.22 ... done Downloading libxml-perl-0.08 ... done Downloading XML-SAX-Writer-0.52 ... done Downloading Clone-0.29 ... done Downloading DB_File-1.816 ... done Downloading IPC-Run-0.82 ... done Downloading XML-DOM-1.44 ... done Downloading XML-XPathEngine-0.11 ... done Downloading IO-stringy-2.110 ... done Downloading OLE-Storage_Lite-0.18 ... done Downloading Ocsinventory-Agent-0.0.9.2 ... done Downloading Cache-Cache-1.05 ... done Downloading Text-Iconv-1.7 ... done Downloading XML-Filter-BufferText-1.01 ... done Downloading XML-NamespaceSupport-1.09 ... done Downloading XML-RegExp-0.03 ... done Downloading Error-0.17015 ... done Unpacking BioPerl-1.5.9_2 ... done Unpacking Bundle-BioPerl-Core-1.5.9_2 ... done Unpacking Math-Random-0.71 ... done Unpacking Bio-ASN1-EntrezGene-1.09 ... done Unpacking Data-Stag-0.11 ... done Unpacking Algorithm-Munkres-0.08 ... done Unpacking GraphViz-2.03 ... done Unpacking XML-Writer-0.606 ... done Unpacking Graph-0.90 ... done Unpacking XML-DOM-XPath-0.14 ... done Unpacking PostScript-0.06 ... done Unpacking Spreadsheet-ParseExcel-0.43 ... done Unpacking XML-SAX-0.96 ... done Unpacking AcePerl-1.92 ... done Unpacking Array-Compare-1.17 ... done Unpacking Convert-Binary-C-0.71 ... done Unpacking XML-Twig-3.32 ... done Unpacking Set-Scalar-1.22 ... done Unpacking libxml-perl-0.08 ... done Unpacking XML-SAX-Writer-0.52 ... done Unpacking Clone-0.29 ... done Unpacking DB_File-1.816 ... done Unpacking IPC-Run-0.82 ... done Unpacking XML-DOM-1.44 ... done Unpacking XML-XPathEngine-0.11 ... done Unpacking IO-stringy-2.110 ... done Unpacking OLE-Storage_Lite-0.18 ... done Unpacking Ocsinventory-Agent-0.0.9.2 ... done Unpacking Cache-Cache-1.05 ... done Unpacking Text-Iconv-1.7 ... done Unpacking XML-Filter-BufferText-1.01 ... done Unpacking XML-NamespaceSupport-1.09 ... done Unpacking XML-RegExp-0.03 ... done Unpacking Error-0.17015 ... done Generating HTML for BioPerl-1.5.9_2 ... done Generating HTML for Math-Random-0.71 ... done Generating HTML for Bio-ASN1-EntrezGene-1.09 ... done Generating HTML for Data-Stag-0.11 ... done Generating HTML for Algorithm-Munkres-0.08 ... done Generating HTML for GraphViz-2.03 ... done Generating HTML for XML-Writer-0.606 ... done Generating HTML for Graph-0.90 ... done Generating HTML for XML-DOM-XPath-0.14 ... done Generating HTML for PostScript-0.06 ... done Generating HTML for Spreadsheet-ParseExcel-0.43 ... done Generating HTML for XML-SAX-0.96 ... done Generating HTML for AcePerl-1.92 ... done Generating HTML for Array-Compare-1.17 ... done Generating HTML for Convert-Binary-C-0.71 ... done Generating HTML for XML-Twig-3.32 ... done Generating HTML for Set-Scalar-1.22 ... done Generating HTML for libxml-perl-0.08 ... done Generating HTML for XML-SAX-Writer-0.52 ... done Generating HTML for Clone-0.29 ... done Generating HTML for DB_File-1.816 ... done Generating HTML for IPC-Run-0.82 ... done Generating HTML for XML-DOM-1.44 ... done Generating HTML for XML-XPathEngine-0.11 ... done Generating HTML for IO-stringy-2.110 ... done Generating HTML for OLE-Storage_Lite-0.18 ... done Generating HTML for Ocsinventory-Agent-0.0.9.2 ... done Generating HTML for Cache-Cache-1.05 ... done Generating HTML for Text-Iconv-1.7 ... done Generating HTML for XML-Filter-BufferText-1.01 ... done Generating HTML for XML-NamespaceSupport-1.09 ... done Generating HTML for XML-RegExp-0.03 ... done Generating HTML for Error-0.17015 ... done Updating files in site area ... failed Installing 34 packages failed ERROR: File conflict for 'C:/Perl/html/site/lib/Bio/Align/AlignI.html'. The package bioperl has already installed a file that package BioPerl wants to install. From cjfields at illinois.edu Fri Jan 9 08:04:06 2009 From: cjfields at illinois.edu (Chris Fields) Date: Fri, 9 Jan 2009 07:04:06 -0600 Subject: [Bioperl-l] Failed Istallation In-Reply-To: References: Message-ID: <17E64B8A-2D49-4C4E-8EB1-4F26C506AD96@illinois.edu> On Jan 9, 2009, at 2:11 AM, Wesley Arthur wrote: > ----- Original Message ----- From: "Chris Fields" > > To: "BioPerl List" > Sent: Thursday, January 08, 2009 3:53 AM > Subject: Re: [Bioperl-l] [ANNOUCEMENT] BioPerl 1.6 RC2 ... > Dear Chris, > Thank you for the latest release of RC 1.5.9_2 with > the ActiveState PPM. My attempt to download this has failed. I am > using Windowas Vista and Activeperl 5.8.8.824. The status tab > diplayed the following; > > Synchronizing Database ... > > Downloading ActiveState Package Repository packlist ... done > > Updating ActiveState Package Repository database ... done > > ... > Generating HTML for Error-0.17015 ... done > > Updating files in site area ... failed > > Installing 34 packages failed > > ERROR: File conflict for 'C:/Perl/html/site/lib/Bio/Align/ > AlignI.html'. > > The package bioperl has already installed a file that package > BioPerl > > wants to install. Do you have an old 'bioperl' PPM installed (1.4, 1.5.2)? We are calling the package BioPerl now (note capitalization), which is a giveaway (the above message has both 'bioperl' and 'BioPerl'). Try uninstalling the older bioperl PPM first, then installing BioPerl. I wondered if this would be a problem, but it doesn't appear to affect anything other than PPM installation. I'll check in with ActiveState on this to see if there is a solution. chris From cjfields at illinois.edu Fri Jan 9 08:09:29 2009 From: cjfields at illinois.edu (Chris Fields) Date: Fri, 9 Jan 2009 07:09:29 -0600 Subject: [Bioperl-l] Failed Istallation In-Reply-To: <17E64B8A-2D49-4C4E-8EB1-4F26C506AD96@illinois.edu> References: <17E64B8A-2D49-4C4E-8EB1-4F26C506AD96@illinois.edu> Message-ID: Forgot to add, if I can get it working I may try this on an old winXP setup in the lab. -c On Jan 9, 2009, at 7:04 AM, Chris Fields wrote: > On Jan 9, 2009, at 2:11 AM, Wesley Arthur wrote: > >> ----- Original Message ----- From: "Chris Fields" > > >> To: "BioPerl List" >> Sent: Thursday, January 08, 2009 3:53 AM >> Subject: Re: [Bioperl-l] [ANNOUCEMENT] BioPerl 1.6 RC2 > > ... >> Dear Chris, >> Thank you for the latest release of RC 1.5.9_2 with >> the ActiveState PPM. My attempt to download this has failed. I am >> using Windowas Vista and Activeperl 5.8.8.824. The status tab >> diplayed the following; >> >> Synchronizing Database ... >> >> Downloading ActiveState Package Repository packlist ... done >> >> Updating ActiveState Package Repository database ... done >> >> ... >> Generating HTML for Error-0.17015 ... done >> >> Updating files in site area ... failed >> >> Installing 34 packages failed >> >> ERROR: File conflict for 'C:/Perl/html/site/lib/Bio/Align/ >> AlignI.html'. >> >> The package bioperl has already installed a file that package >> BioPerl >> >> wants to install. > > Do you have an old 'bioperl' PPM installed (1.4, 1.5.2)? We are > calling the package BioPerl now (note capitalization), which is a > giveaway (the above message has both 'bioperl' and 'BioPerl'). Try > uninstalling the older bioperl PPM first, then installing BioPerl. > > I wondered if this would be a problem, but it doesn't appear to > affect anything other than PPM installation. I'll check in with > ActiveState on this to see if there is a solution. > > chris > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From avilella at gmail.com Fri Jan 9 09:00:43 2009 From: avilella at gmail.com (Albert Vilella) Date: Fri, 9 Jan 2009 14:00:43 +0000 Subject: [Bioperl-l] Bioperl representatives for the Biohackathon 2009 in Japan Message-ID: <358f4d650901090600h65c5edb4ofe1af0a4e173d846@mail.gmail.com> Hi, Has anyone thought of representing BioPerl in the Biohackathon 2009 in Japan? Maybe that would be a good opportunity to code for the BioPerl<->BioC discussions that have taken place in the list, http://hackathon2.dbcls.jp/#Goals Cheers, Albert. PD: Sorry if this has already been brought up in the list, I couldn't find any messages regarding it. From abhishek.vit at gmail.com Fri Jan 9 12:03:11 2009 From: abhishek.vit at gmail.com (Abhishek Pratap) Date: Fri, 9 Jan 2009 12:03:11 -0500 Subject: [Bioperl-l] Counting Homopolymer regions Message-ID: Hello All Is there a quick way to find the homopolymer stretches in the contigs and also report their base start and end positions. Thanks, -Abhi -- ----------------------------- Abhishek Pratap Bioinformatics Software Engineer Institute for Genome Sciences School of Medicine, Univ of Maryland 801, W. Baltimore Street, Baltimore, MD 21209 Ph: (+1)-410-706-2296 www.igs.umaryland.edu/ Chair RSG-Worldwide ISCB-Student Council http://iscbsc.org/rsg www.bioinfosolutions.com From cjfields at illinois.edu Sat Jan 10 17:01:58 2009 From: cjfields at illinois.edu (Chris Fields) Date: Sat, 10 Jan 2009 16:01:58 -0600 Subject: [Bioperl-l] Need some bioperl-run tests Message-ID: All, I have been updating bioperl-run tests in subversion to use Bio::Root::Test. I need devs and anyone interested to check out the latest bioperl-run and run tests checking for failures. I'll start tracking errors. I have also noticed that Pise.t and AnalysisFactory_soap.t tests are failing. I have updated the tests so they run to completion, but (if possible) I need some indication whether these web services are still available and should be incldued in a BioPerl-run 1.6 release. -c cjfields:run cjfields$ perl -MSOAP::Lite -M5.010 -e 'say $SOAP::Lite::VERSION' 0.710.08 cjfields:run cjfields$ perl -v This is perl, v5.10.0 built for darwin-2level Copyright 1987-2007, Larry Wall ... cjfields:run cjfields$ ./Build test --test-files t/ AnalysisFactory_soap.t --test-files t/Pise.t --verbose t/AnalysisFactory_soap...... 1..12 ok 1 - use Bio::Tools::Run::AnalysisFactory; ok 2 - The object isa Bio::Tools::Run::AnalysisFactory ok 3 - The object isa Bio::Tools::Run::AnalysisFactory ok 4 - Non existant access method threw an error ok 5 - use SOAP::Lite; ok 6 - The object isa ARRAY ok 7 - available_categories returned category with protein ok 8 - The object isa ARRAY ok 9 - available_analyses returned category with seqret ok 10 - The object isa ARRAY ok 11 - available_analyses("edit") returned something not ok 12 # Failed test at t/AnalysisFactory_soap.t line 51. # create_analysis failed :proxy: transport protocol not specified # Looks like you failed 1 test of 12. Dubious, test returned 1 (wstat 256, 0x100) Failed 1/12 subtests t/Pise...................... 1..15 ok 1 - use Bio::Tools::Run::tRNAscanSE; ok 2 - use Bio::Root::IO; ok 3 - use Bio::Seq; ok 4 - use XML::Parser::PerlSAX; Subroutine stdout redefined at /Users/cjfields/bioperl/run/Bio/Tools/ Run/PiseJob.pm line 609. Subroutine stderr redefined at /Users/cjfields/bioperl/run/Bio/Tools/ Run/PiseJob.pm line 644. ok 5 - use Bio::Tools::Run::AnalysisFactory::Pise; ok 6 - use Bio::Tools::Genscan; ok 7 - use Bio::SeqIO; ok 8 - The object isa Bio::Tools::Run::AnalysisFactory::Pise ok 9 - The object isa Bio::Tools::Run::PiseApplication::golden ok 10 - The object isa Bio::Tools::Run::PiseJob not ok 11 - No error # Error: Bio::Tools::Run::PiseJob _submit: Moved Permanently # Failed test 'No error' # at t/Pise.t line 69. ok 12 # SKIP Job Error ok 13 # SKIP Job Error ok 14 # SKIP Job Error ok 15 # SKIP Job Error # Looks like you failed 1 test of 15. Dubious, test returned 1 (wstat 256, 0x100) Failed 1/15 subtests (less 4 skipped subtests: 10 okay) Test Summary Report ------------------- t/AnalysisFactory_soap.t (Wstat: 256 Tests: 12 Failed: 1) Failed test: 12 Non-zero exit status: 1 t/Pise.t (Wstat: 256 Tests: 15 Failed: 1) Failed test: 11 Non-zero exit status: 1 Files=2, Tests=27, 16 wallclock secs ( 0.02 usr 0.01 sys + 1.00 cusr 0.17 csys = 1.20 CPU) Result: FAIL Failed 2/2 test programs. 2/27 subtests failed. From cjfields at illinois.edu Sun Jan 11 16:13:10 2009 From: cjfields at illinois.edu (Chris Fields) Date: Sun, 11 Jan 2009 15:13:10 -0600 Subject: [Bioperl-l] Deprecate Pise modules? was: Need some bioperl-run tests References: Message-ID: <972B53FE-DD38-4D9F-BC2B-A9F0C79170A9@illinois.edu> All, We'll probably deprecate the Pise modules (according to Catherine's response below) unless someone wants to take them over (the service has been discontinued). This will (in effect) remove 285 modules from bioperl-run. They won't be included in the 1.6 release since the tests won't pass, but it's possible the module may come in useful for setting up a bioperl API for mobyle. Should we leave them in the bioperl-run main trunk or remove them? chris Begin forwarded message: > On Jan 11, 2009, at 11:57 AM, Catherine Letondal wrote: > >> Hi, >> >> Le 10 janv. 09 ? 23:01, Chris Fields a ?crit : >> >>> All, >>> >>> I have been updating bioperl-run tests in subversion to use >>> Bio::Root::Test. I need devs and anyone interested to check out >>> the latest bioperl-run and run tests checking for failures. I'll >>> start tracking errors. >>> >>> I have also noticed that Pise.t and AnalysisFactory_soap.t tests >>> are failing. I have updated the tests so they run to completion, >>> but (if possible) I need some indication whether these web >>> services are still available and should be incldued in a BioPerl- >>> run 1.6 release. >>> >> >> No, they are no longer available - Pise server has been replaced by >> mobyle.pasteur.fr, which does not yet offer a bioperl API. I had >> sent a message to the bioperl mailing-list a few monthes ago about >> this service being discontinued, but the message had been rejected. >> It is possible to change the default Pise server address - provided >> someone else is willing to offer these services. If not, you can >> either remove the test or better, remove the Pise modules. >> >> Best, >> >> Catherine Letondal > > Thanks for letting us know Catherine. I'll forward your response to > the mail list to get everyone's response. > > I'll remove the Pise modules from the 1.6 branch when it's ready > (should be the next day or two). We'll likely also remove it from > main trunk if no one wants to take it over. The effort into > maintaining it would probably be better spent towards developing a > mobyle API if anyone's interested. > > chris From sherlock at genome.stanford.edu Sun Jan 11 18:31:02 2009 From: sherlock at genome.stanford.edu (Gavin Sherlock) Date: Sun, 11 Jan 2009 15:31:02 -0800 Subject: [Bioperl-l] job opening for a Perl Developer Message-ID: Hi all, Apologies if a job posting here is inappropriate for the list, but I thought it a good way to reach BioPerl developers. I have a newly funded database (the Aspergillus Genome Database), which will reuse the code from the Candida Genome Database (which in turn was taken from SGD), and have an open position for a Perl programmer that I would like to fill ASAP. The project us funded for the next 5 years. Most of the code is object oriented, and we use BioPerl for some of the sequence manipulations. We will be doing significant development on the code base, and also want to make it much more robust by developing a test suite, which doesn't really exist at the moment. More information about the position (#33459), and is available at the Stanford jobs site: http://jobs.stanford.edu/index.html http://recruit.trovix.com/jobhostmaster/jobhost/ViewJobPostDetails.do?title=APPLICATION+SOFTWARE+DEVELOPER&jobPostId=zhdk4rqvyfbydkj2imehlnm6cc&accountId=de85ad313f8598db1c42b567a3df24a00497ba22&button=&action=viewDetails&tid=0207-zurgwxrgonhhtgm7a2utx6eb4h Cheers, Gavin ________________________________________________________ Gavin Sherlock Assistant Professor, Research Dept. of Genetics S201A, Grant Building, Stanford University Medical School, Stanford, CA 94305-5120 Tel: 650 498 6012 Fax: 650 724 3701 http://genome-www.stanford.edu/~sherlock From bix at sendu.me.uk Sun Jan 11 19:45:49 2009 From: bix at sendu.me.uk (Sendu Bala) Date: Mon, 12 Jan 2009 00:45:49 +0000 Subject: [Bioperl-l] Remove Makefile.PL stub from version control? Message-ID: <496A92BD.6010305@sendu.me.uk> Does anyone still think we need the Makefile.PL stub in svn? It just prints out info for those not used to Build.PL. It is overwritten during the build process so end-users who download BioPerl via CPAN etc. don't ever see it. From jason at bioperl.org Sun Jan 11 20:44:07 2009 From: jason at bioperl.org (Jason Stajich) Date: Sun, 11 Jan 2009 17:44:07 -0800 Subject: [Bioperl-l] Deprecate Pise modules? was: Need some bioperl-run tests In-Reply-To: <972B53FE-DD38-4D9F-BC2B-A9F0C79170A9@illinois.edu> References: <972B53FE-DD38-4D9F-BC2B-A9F0C79170A9@illinois.edu> Message-ID: One thought is we could do is package them up in bioperl-pise in the event that anyone else had setup a pise server and wanted to use it - that was sort of what iNquiry provided I thought. Since in this instance they are all related it could be best to keep them in the same package and helps separate them from the core. I had hoped that eventually parameters & methodnames & validation for the webservices would to be autogenerated from the same XML/Grammar files that were used to generate the front ends rather than having to code method names explicitly in all the modules. But I guess there will always be bridging code that converts the Bio::Seq object into the sequence data stream the webservice needs. At any rate - I agree pull them out of bioperl-run for 1.6, but maybe migrate them to a new package for any future development. bioperl- mobyle could eventually be launched if the devs want to see it available. -jason On Jan 11, 2009, at 1:13 PM, Chris Fields wrote: > All, > > We'll probably deprecate the Pise modules (according to Catherine's > response below) unless someone wants to take them over (the service > has been discontinued). This will (in effect) remove 285 modules > from bioperl-run. > > They won't be included in the 1.6 release since the tests won't > pass, but it's possible the module may come in useful for setting up > a bioperl API for mobyle. Should we leave them in the bioperl-run > main trunk or remove them? > > chris > > Begin forwarded message: > >> On Jan 11, 2009, at 11:57 AM, Catherine Letondal wrote: >> >>> Hi, >>> >>> Le 10 janv. 09 ? 23:01, Chris Fields a ?crit : >>> >>>> All, >>>> >>>> I have been updating bioperl-run tests in subversion to use >>>> Bio::Root::Test. I need devs and anyone interested to check out >>>> the latest bioperl-run and run tests checking for failures. I'll >>>> start tracking errors. >>>> >>>> I have also noticed that Pise.t and AnalysisFactory_soap.t tests >>>> are failing. I have updated the tests so they run to completion, >>>> but (if possible) I need some indication whether these web >>>> services are still available and should be incldued in a BioPerl- >>>> run 1.6 release. >>>> >>> >>> No, they are no longer available - Pise server has been replaced >>> by mobyle.pasteur.fr, which does not yet offer a bioperl API. I >>> had sent a message to the bioperl mailing-list a few monthes ago >>> about this service being discontinued, but the message had been >>> rejected. It is possible to change the default Pise server address >>> - provided someone else is willing to offer these services. If >>> not, you can either remove the test or better, remove the Pise >>> modules. >>> >>> Best, >>> >>> Catherine Letondal >> >> Thanks for letting us know Catherine. I'll forward your response >> to the mail list to get everyone's response. >> >> I'll remove the Pise modules from the 1.6 branch when it's ready >> (should be the next day or two). We'll likely also remove it from >> main trunk if no one wants to take it over. The effort into >> maintaining it would probably be better spent towards developing a >> mobyle API if anyone's interested. >> >> chris > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l Jason Stajich jason at bioperl.org From cjfields at illinois.edu Sun Jan 11 21:08:47 2009 From: cjfields at illinois.edu (Chris Fields) Date: Sun, 11 Jan 2009 20:08:47 -0600 Subject: [Bioperl-l] Remove Makefile.PL stub from version control? In-Reply-To: <496A92BD.6010305@sendu.me.uk> References: <496A92BD.6010305@sendu.me.uk> Message-ID: <8209D92C-9CB2-419C-9C72-6059232C136F@illinois.edu> Sendu, Go ahead and remove it; I see no reason for it (we've been using Build.PL for a while now). I'll remove the same from the branch. Thanks for the cleanups on db and run. I'll try getting a third RC (and a first RC for db and run). I'll work on bioperl-network next; do we want any others (pedigree maybe)? chris On Jan 11, 2009, at 6:45 PM, Sendu Bala wrote: > Does anyone still think we need the Makefile.PL stub in svn? It just > prints out info for those not used to Build.PL. It is overwritten > during the build process so end-users who download BioPerl via CPAN > etc. don't ever see it. > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From cjfields at illinois.edu Sun Jan 11 21:16:27 2009 From: cjfields at illinois.edu (Chris Fields) Date: Sun, 11 Jan 2009 20:16:27 -0600 Subject: [Bioperl-l] Deprecate Pise modules? was: Need some bioperl-run tests In-Reply-To: References: <972B53FE-DD38-4D9F-BC2B-A9F0C79170A9@illinois.edu> Message-ID: Works for me. We can work on migrating the (non-working) tests and some minimal docs over as well. chris On Jan 11, 2009, at 7:44 PM, Jason Stajich wrote: > > One thought is we could do is package them up in bioperl-pise in the > event that anyone else had setup a pise server and wanted to use it > - that was sort of what iNquiry provided I thought. Since in this > instance they are all related it could be best to keep them in the > same package and helps separate them from the core. > > I had hoped that eventually parameters & methodnames & validation > for the webservices would to be autogenerated from the same XML/ > Grammar files that were used to generate the front ends rather than > having to code method names explicitly in all the modules. But I > guess there will always be bridging code that converts the Bio::Seq > object into the sequence data stream the webservice needs. > > At any rate - I agree pull them out of bioperl-run for 1.6, but > maybe migrate them to a new package for any future development. > bioperl-mobyle could eventually be launched if the devs want to see > it available. > > -jason > On Jan 11, 2009, at 1:13 PM, Chris Fields wrote: > >> All, >> >> We'll probably deprecate the Pise modules (according to Catherine's >> response below) unless someone wants to take them over (the service >> has been discontinued). This will (in effect) remove 285 modules >> from bioperl-run. >> >> They won't be included in the 1.6 release since the tests won't >> pass, but it's possible the module may come in useful for setting >> up a bioperl API for mobyle. Should we leave them in the bioperl- >> run main trunk or remove them? >> >> chris >> >> Begin forwarded message: >> >>> On Jan 11, 2009, at 11:57 AM, Catherine Letondal wrote: >>> >>>> Hi, >>>> >>>> Le 10 janv. 09 ? 23:01, Chris Fields a ?crit : >>>> >>>>> All, >>>>> >>>>> I have been updating bioperl-run tests in subversion to use >>>>> Bio::Root::Test. I need devs and anyone interested to check out >>>>> the latest bioperl-run and run tests checking for failures. >>>>> I'll start tracking errors. >>>>> >>>>> I have also noticed that Pise.t and AnalysisFactory_soap.t tests >>>>> are failing. I have updated the tests so they run to >>>>> completion, but (if possible) I need some indication whether >>>>> these web services are still available and should be incldued in >>>>> a BioPerl-run 1.6 release. >>>>> >>>> >>>> No, they are no longer available - Pise server has been replaced >>>> by mobyle.pasteur.fr, which does not yet offer a bioperl API. I >>>> had sent a message to the bioperl mailing-list a few monthes ago >>>> about this service being discontinued, but the message had been >>>> rejected. It is possible to change the default Pise server >>>> address - provided someone else is willing to offer these >>>> services. If not, you can either remove the test or better, >>>> remove the Pise modules. >>>> >>>> Best, >>>> >>>> Catherine Letondal >>> >>> Thanks for letting us know Catherine. I'll forward your response >>> to the mail list to get everyone's response. >>> >>> I'll remove the Pise modules from the 1.6 branch when it's ready >>> (should be the next day or two). We'll likely also remove it from >>> main trunk if no one wants to take it over. The effort into >>> maintaining it would probably be better spent towards developing a >>> mobyle API if anyone's interested. >>> >>> chris >> >> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > > Jason Stajich > jason at bioperl.org > > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From shameer at ncbs.res.in Mon Jan 12 06:23:24 2009 From: shameer at ncbs.res.in (K. Shameer) Date: Mon, 12 Jan 2009 16:53:24 +0530 (IST) Subject: [Bioperl-l] Heat map module ? Message-ID: <46158.192.168.1.1.1231759404.squirrel@mail.ncbs.res.in> Hi, I am looking for an option to plot some values (ranges from -ve to positive) in a grey-scale heat map. Is there any way to do it using any bioperl/perl modules ? Any examples ? Thanks in advance, K. Shameer NCBS - TIFR From heikki.lehvaslaiho at gmail.com Mon Jan 12 08:33:51 2009 From: heikki.lehvaslaiho at gmail.com (Heikki Lehvaslaiho) Date: Mon, 12 Jan 2009 15:33:51 +0200 Subject: [Bioperl-l] Counting Homopolymer regions In-Reply-To: References: Message-ID: If you can load the sequence strings into memory, I'd use a regular expression to detect the homopolymers and the use the pos function to find the location of hits: $s = "AGGGGGGGAAAAACGATCGGGGGGGTGTGGGGGCCCCCGTG"; $min = 4; while ( $s =~ /(A{$min,}|T{$min,}|G{$min,}|C{$min,})/g) { $end = pos($s); $start = $end - length($1) + 1; print "$start, $end, $1 \n"; } -Heikki 2009/1/9 Abhishek Pratap : > Hello All > > > Is there a quick way to find the homopolymer stretches in the contigs and > also report their base start and end positions. > > Thanks, > -Abhi > > -- > ----------------------------- > Abhishek Pratap > Bioinformatics Software Engineer > Institute for Genome Sciences > School of Medicine, Univ of Maryland > 801, W. Baltimore Street, Baltimore, MD 21209 > Ph: (+1)-410-706-2296 > www.igs.umaryland.edu/ > > Chair > RSG-Worldwide > ISCB-Student Council > http://iscbsc.org/rsg > > www.bioinfosolutions.com > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > -- -Heikki Heikki Lehvaslaiho - heikki lehvaslaiho gmail com http://kapkaupunki.blogspot.com/ From jason at bioperl.org Mon Jan 12 09:29:19 2009 From: jason at bioperl.org (Jason Stajich) Date: Mon, 12 Jan 2009 15:29:19 +0100 Subject: [Bioperl-l] Heat map module ? In-Reply-To: <46158.192.168.1.1.1231759404.squirrel@mail.ncbs.res.in> References: <46158.192.168.1.1.1231759404.squirrel@mail.ncbs.res.in> Message-ID: Seems like R is a better place for this - there are heatmap modules in there. Otherwise GD is what you want for plotting. There is a heat_map-type rendering glyph in Gbrowse if you want to see this type of stuff across the genome. -jason On Jan 12, 2009, at 12:23 PM, K. Shameer wrote: > Hi, > > I am looking for an option to plot some values (ranges from -ve to > positive) in a grey-scale heat map. Is there any way to do it using > any > bioperl/perl modules ? Any examples ? > > Thanks in advance, > K. Shameer > NCBS - TIFR > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l Jason Stajich jason at bioperl.org From shameer at ncbs.res.in Mon Jan 12 09:49:09 2009 From: shameer at ncbs.res.in (K. Shameer) Date: Mon, 12 Jan 2009 20:19:09 +0530 (IST) Subject: [Bioperl-l] Heat map module ? In-Reply-To: References: <46158.192.168.1.1.1231759404.squirrel@mail.ncbs.res.in> Message-ID: <51950.192.168.1.1.1231771749.squirrel@mail.ncbs.res.in> Hi Jason, Thanks for your suggestions. I tried Statistics::R, but failed to install it properly. I need to generate these plots on-the-fly with in a web server, thats why I prefer to do it using Perl than R. Thanks for the pointer towards 'heat_map' glyph. I am looking for something similar to this, but not in a genome/gbrowse context. For example, I have 25*3 matrix with some values. I need to plot it based on a gray scale heat map. K. Shameer NCBS - TIFR > Seems like R is a better place for this - there are heatmap modules in > there. > Otherwise GD is what you want for plotting. > > There is a heat_map-type rendering glyph in Gbrowse if you want to see > this type of stuff across the genome. > > -jason > From jason at bioperl.org Mon Jan 12 10:28:54 2009 From: jason at bioperl.org (Jason Stajich) Date: Mon, 12 Jan 2009 16:28:54 +0100 Subject: [Bioperl-l] Heat map module ? In-Reply-To: <51950.192.168.1.1.1231771749.squirrel@mail.ncbs.res.in> References: <46158.192.168.1.1.1231759404.squirrel@mail.ncbs.res.in> <51950.192.168.1.1.1231771749.squirrel@mail.ncbs.res.in> Message-ID: Personally I'd not try and run R within RSPerl or the like so much as I'd 1) write my data file out in a nice table (to a tempdir) 2) write out a file with the series of R commands you need to make the heatmap (with full path to the datafile) have the script generate a PNG 3) run the command `R --no-save < tempdir/tempscript.R 4) return the PNG as the result from the cgi and/or tempfile and/or using a CGI session 5) cleanup the tempdir and depending on what you do, tag the png file for cleanup after a certain time. -jason On Jan 12, 2009, at 3:49 PM, K. Shameer wrote: > Hi Jason, > > Thanks for your suggestions. > > I tried Statistics::R, but failed to install it properly. I need to > generate these plots on-the-fly with in a web server, thats why I > prefer > to do it using Perl than R. > > Thanks for the pointer towards 'heat_map' glyph. I am looking for > something similar to this, but not in a genome/gbrowse context. For > example, I have 25*3 matrix with some values. I need to plot it > based on a > gray scale heat map. > > K. Shameer > NCBS - TIFR > > > > >> Seems like R is a better place for this - there are heatmap modules >> in >> there. >> Otherwise GD is what you want for plotting. >> >> There is a heat_map-type rendering glyph in Gbrowse if you want to >> see >> this type of stuff across the genome. >> >> -jason >> > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l Jason Stajich jason at bioperl.org From Samantha.Thompson at greenbiologics.com Mon Jan 12 12:45:53 2009 From: Samantha.Thompson at greenbiologics.com (Samantha Thompson) Date: Mon, 12 Jan 2009 17:45:53 -0000 Subject: [Bioperl-l] Degenerate primer calculation References: <0F8B16D2-8DFC-4EC5-B99B-74A91C92B1B8@illinois.edu> Message-ID: -----Original Message----- From: Chris Fields [mailto:cjfields at illinois.edu] Sent: 08 December 2008 16:41 To: Samantha Thompson Cc: bioperl-l List Subject: Re: [Bioperl-l] Degenerate primer calculation On Dec 8, 2008, at 9:59 AM, Samantha Thompson wrote: > Hi, > > I also have another similar sequence analysis/primer problem. > > What I'd like to do is produce degenerate primers from amino acid > sequences. > > What I did initially was take the codon usage table and rewrite it > in a > hash in perl in the form of degenerate codon usage e.g Lysine/K > would be > AAR, its reverse complement would be YTT. So my form then takes an > amino > acid sequence (derived as a consensus from multiple the alignment of > homologous proteins) and converts them into degenerate codons and then > that degenerate primer (actually several primers synthesised with > different bases pooled together), in order to search for homologues to > the protein in unsequenced organisms. > > I would like to improve this by being able to take a consensus > described > more in the form of a Prosite motif (I think thats the right one) such > as [TS]YW[RKSD] and then develop a degenerate nucleotide sequence > corresponding to this. > > So I'm wondering if bioperl contains anything like this (both prosite > motif format parsing and degenerate code from multiple alignments or > such a motif), or if I need to write this myself (which I want to if > it > doesn't exist already). > > Thanks again, > > Sam Bio::Tools::CodonTable reverse translates, but I don't think it accepts patterns. Maybe a pipeline including Bio::Tools::SeqPattern? Might be an interesting programming challenge if it isn't already set up for that. Chris ........... Hi, I'm trying to have a go at solving this problem and I'm looking at Bio::Tools::SeqPattern. What I would like to be able to obtain from a motif is a list of all the sequences that that sequence could correspond to. E.g IKL[GP]NM could be IKLGNM or IKLPNM ... so I take both of these sequences and turn them into degenerate codons for each amino acid. The complicated part (I thought) here is creating a degenerate codon that corresponds to either G or P. The way I will do this is by producing each of the 3 degenerate bases and creating a new codon by creating each of the 3 degenerate bases separately based on a 2D matrix which contains the result of 'crossing' each of the nucleotide bases of the degenerate code with each other. So when you cross the codon for G (GGN) with the codon for P (CCN) you get a codon that contains the degeneracy of both (SSN). So then you have a degenerate nucleotide sequence for your peptide motif. I have written this part already but I am wondering about the expand function of Bio::Tools::SeqPattern . I'm not quite sure what it means by the expanded sequence (if there is just one?) that it returns. I'm trying to get every possible permutation of the motif is there any function that does this or will I have to write one to parse it myself? ..... This would be great, but what would make things even better would be if I could take multiple sequence alignments and produce patterns/motifs from them. Is there a part of BioPerl that does something like this? Thanks, Sam From abhishek.vit at gmail.com Mon Jan 12 14:06:13 2009 From: abhishek.vit at gmail.com (Abhishek Pratap) Date: Mon, 12 Jan 2009 14:06:13 -0500 Subject: [Bioperl-l] Counting Homopolymer regions In-Reply-To: References: Message-ID: Hi Heikki Thanks for a quick reply. Just wondering what happens if there are multiple homopolymeric regions in a sequence/contig ? Thanks, -Abhi On Mon, Jan 12, 2009 at 8:33 AM, Heikki Lehvaslaiho < heikki.lehvaslaiho at gmail.com> wrote: > If you can load the sequence strings into memory, I'd use a regular > expression to detect the homopolymers and the use the pos function to > find the location of hits: > > > $s = "AGGGGGGGAAAAACGATCGGGGGGGTGTGGGGGCCCCCGTG"; > $min = 4; > > while ( $s =~ /(A{$min,}|T{$min,}|G{$min,}|C{$min,})/g) { > $end = pos($s); > $start = $end - length($1) + 1; > print "$start, $end, $1 \n"; > } > > > -Heikki > > 2009/1/9 Abhishek Pratap : > > Hello All > > > > > > Is there a quick way to find the homopolymer stretches in the contigs and > > also report their base start and end positions. > > > > Thanks, > > -Abhi > > > > -- > > ----------------------------- > > Abhishek Pratap > > Bioinformatics Software Engineer > > Institute for Genome Sciences > > School of Medicine, Univ of Maryland > > 801, W. Baltimore Street, Baltimore, MD 21209 > > Ph: (+1)-410-706-2296 > > www.igs.umaryland.edu/ > > > > Chair > > RSG-Worldwide > > ISCB-Student Council > > http://iscbsc.org/rsg > > > > www.bioinfosolutions.com > > _______________________________________________ > > Bioperl-l mailing list > > Bioperl-l at lists.open-bio.org > > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > > > > > -- > -Heikki > Heikki Lehvaslaiho - heikki lehvaslaiho gmail com > http://kapkaupunki.blogspot.com/ > -- ----------------------------- Abhishek Pratap Bioinformatics Software Engineer Institute for Genome Sciences School of Medicine, Univ of Maryland 801, W. Baltimore Street, Baltimore, MD 21209 Ph: (+1)-410-706-2296 www.igs.umaryland.edu/ Chair RSG-Worldwide ISCB-Student Council http://iscbsc.org/rsg www.bioinfosolutions.com From skalla at rice.edu Mon Jan 12 15:09:47 2009 From: skalla at rice.edu (Sara Kalla) Date: Mon, 12 Jan 2009 14:09:47 -0600 Subject: [Bioperl-l] Degenerate primer calculation In-Reply-To: References: <0F8B16D2-8DFC-4EC5-B99B-74A91C92B1B8@illinois.edu> Message-ID: <496BA38B.9010903@rice.edu> Samantha Thompson wrote: > -----Original Message----- > From: Chris Fields [mailto:cjfields at illinois.edu] > Sent: 08 December 2008 16:41 > To: Samantha Thompson > Cc: bioperl-l List > Subject: Re: [Bioperl-l] Degenerate primer calculation > > > On Dec 8, 2008, at 9:59 AM, Samantha Thompson wrote: > > >> Hi, >> >> I also have another similar sequence analysis/primer problem. >> >> What I'd like to do is produce degenerate primers from amino acid >> sequences. >> >> What I did initially was take the codon usage table and rewrite it >> in a >> hash in perl in the form of degenerate codon usage e.g Lysine/K >> would be >> AAR, its reverse complement would be YTT. So my form then takes an >> amino >> acid sequence (derived as a consensus from multiple the alignment of >> homologous proteins) and converts them into degenerate codons and then >> that degenerate primer (actually several primers synthesised with >> different bases pooled together), in order to search for homologues to >> the protein in unsequenced organisms. >> >> I would like to improve this by being able to take a consensus >> described >> more in the form of a Prosite motif (I think thats the right one) such >> as [TS]YW[RKSD] and then develop a degenerate nucleotide sequence >> corresponding to this. >> >> So I'm wondering if bioperl contains anything like this (both prosite >> motif format parsing and degenerate code from multiple alignments or >> such a motif), or if I need to write this myself (which I want to if >> it >> doesn't exist already). >> >> Thanks again, >> >> Sam >> > > Bio::Tools::CodonTable reverse translates, but I don't think it > accepts patterns. Maybe a pipeline including Bio::Tools::SeqPattern? > Might be an interesting programming challenge if it isn't already set > up for that. > > Chris > ........... > Hi, > > I'm trying to have a go at solving this problem and I'm looking at > Bio::Tools::SeqPattern. What I would like to be able to obtain from a > motif is a list of all the sequences that that sequence could correspond > to. E.g IKL[GP]NM could be IKLGNM or IKLPNM ... so I take both of these > sequences and turn them into degenerate codons for each amino acid. The > complicated part (I thought) here is creating a degenerate codon that > corresponds to either G or P. The way I will do this is by producing > each of the 3 degenerate bases and creating a new codon by creating each > of the 3 degenerate bases separately based on a 2D matrix which contains > the result of 'crossing' each of the nucleotide bases of the degenerate > code with each other. So when you cross the codon for G (GGN) with the > codon for P (CCN) you get a codon that contains the degeneracy of both > (SSN). So then you have a degenerate nucleotide sequence for your > peptide motif. > I have written this part already but I am wondering about the expand > function of Bio::Tools::SeqPattern . I'm not quite sure what it means by > the expanded sequence (if there is just one?) that it returns. I'm > trying to get every possible permutation of the motif is there any > function that does this or will I have to write one to parse it myself? > ..... > This would be great, but what would make things even better would be if > I could take multiple sequence alignments and produce patterns/motifs > from them. Is there a part of BioPerl that does something like this? > > Thanks, > > Sam > Correct me if I'm wrong (or if it's not relevant)... If you use the example above with G (GGN) and P (CCN) and combine to give SSN, wouldn't you also get everything that had an A (GCN) or a R (CGN) at that residue? -Sara From heikki.lehvaslaiho at gmail.com Tue Jan 13 03:22:48 2009 From: heikki.lehvaslaiho at gmail.com (Heikki Lehvaslaiho) Date: Tue, 13 Jan 2009 10:22:48 +0200 Subject: [Bioperl-l] Counting Homopolymer regions In-Reply-To: References: Message-ID: Dear Abhi, I am not sure what you mean. Could you post a short sequence that has a "multiple homopolymeric region". The script I posted detects pure runs of any homopolymers. You have to set a lower limit to the length, collect them all to a data structure (a hash, usually), and then decide what to do with them (combine, define a larger region, ...). All depends what you want to accomplish with this. -Heikki 2009/1/12 Abhishek Pratap : > Hi Heikki > > Thanks for a quick reply. > > Just wondering what happens if there are multiple homopolymeric regions in a > sequence/contig ? > > Thanks, > -Abhi > > On Mon, Jan 12, 2009 at 8:33 AM, Heikki Lehvaslaiho > wrote: >> >> If you can load the sequence strings into memory, I'd use a regular >> expression to detect the homopolymers and the use the pos function to >> find the location of hits: >> >> >> $s = "AGGGGGGGAAAAACGATCGGGGGGGTGTGGGGGCCCCCGTG"; >> $min = 4; >> >> while ( $s =~ /(A{$min,}|T{$min,}|G{$min,}|C{$min,})/g) { >> $end = pos($s); >> $start = $end - length($1) + 1; >> print "$start, $end, $1 \n"; >> } >> >> >> -Heikki >> >> 2009/1/9 Abhishek Pratap : >> > Hello All >> > >> > >> > Is there a quick way to find the homopolymer stretches in the contigs >> > and >> > also report their base start and end positions. >> > >> > Thanks, >> > -Abhi >> > >> > -- >> > ----------------------------- >> > Abhishek Pratap >> > Bioinformatics Software Engineer >> > Institute for Genome Sciences >> > School of Medicine, Univ of Maryland >> > 801, W. Baltimore Street, Baltimore, MD 21209 >> > Ph: (+1)-410-706-2296 >> > www.igs.umaryland.edu/ >> > >> > Chair >> > RSG-Worldwide >> > ISCB-Student Council >> > http://iscbsc.org/rsg >> > >> > www.bioinfosolutions.com >> > _______________________________________________ >> > Bioperl-l mailing list >> > Bioperl-l at lists.open-bio.org >> > http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > >> >> >> >> -- >> -Heikki >> Heikki Lehvaslaiho - heikki lehvaslaiho gmail com >> http://kapkaupunki.blogspot.com/ > > > > -- > ----------------------------- > Abhishek Pratap > Bioinformatics Software Engineer > Institute for Genome Sciences > School of Medicine, Univ of Maryland > 801, W. Baltimore Street, Baltimore, MD 21209 > Ph: (+1)-410-706-2296 > www.igs.umaryland.edu/ > > Chair > RSG-Worldwide > ISCB-Student Council > http://iscbsc.org/rsg > > www.bioinfosolutions.com > > -- -Heikki Heikki Lehvaslaiho - heikki lehvaslaiho gmail com http://kapkaupunki.blogspot.com/ From Samantha.Thompson at greenbiologics.com Tue Jan 13 04:22:15 2009 From: Samantha.Thompson at greenbiologics.com (Samantha Thompson) Date: Tue, 13 Jan 2009 09:22:15 -0000 Subject: [Bioperl-l] Degenerate primer calculation References: <0F8B16D2-8DFC-4EC5-B99B-74A91C92B1B8@illinois.edu> <496BA38B.9010903@rice.edu> Message-ID: -----Original Message----- From: Sara Kalla [mailto:skalla at rice.edu] Sent: 12 January 2009 20:10 To: Samantha Thompson Cc: bioperl-l List Subject: Re: [Bioperl-l] Degenerate primer calculation Samantha Thompson wrote: > -----Original Message----- > From: Chris Fields [mailto:cjfields at illinois.edu] > Sent: 08 December 2008 16:41 > To: Samantha Thompson > Cc: bioperl-l List > Subject: Re: [Bioperl-l] Degenerate primer calculation > > > On Dec 8, 2008, at 9:59 AM, Samantha Thompson wrote: > > >> Hi, >> >> I also have another similar sequence analysis/primer problem. >> >> What I'd like to do is produce degenerate primers from amino acid >> sequences. >> >> What I did initially was take the codon usage table and rewrite it >> in a >> hash in perl in the form of degenerate codon usage e.g Lysine/K >> would be >> AAR, its reverse complement would be YTT. So my form then takes an >> amino >> acid sequence (derived as a consensus from multiple the alignment of >> homologous proteins) and converts them into degenerate codons and then >> that degenerate primer (actually several primers synthesised with >> different bases pooled together), in order to search for homologues to >> the protein in unsequenced organisms. >> >> I would like to improve this by being able to take a consensus >> described >> more in the form of a Prosite motif (I think thats the right one) such >> as [TS]YW[RKSD] and then develop a degenerate nucleotide sequence >> corresponding to this. >> >> So I'm wondering if bioperl contains anything like this (both prosite >> motif format parsing and degenerate code from multiple alignments or >> such a motif), or if I need to write this myself (which I want to if >> it >> doesn't exist already). >> >> Thanks again, >> >> Sam >> > > Bio::Tools::CodonTable reverse translates, but I don't think it > accepts patterns. Maybe a pipeline including Bio::Tools::SeqPattern? > Might be an interesting programming challenge if it isn't already set > up for that. > > Chris > ........... > Hi, > > I'm trying to have a go at solving this problem and I'm looking at > Bio::Tools::SeqPattern. What I would like to be able to obtain from a > motif is a list of all the sequences that that sequence could correspond > to. E.g IKL[GP]NM could be IKLGNM or IKLPNM ... so I take both of these > sequences and turn them into degenerate codons for each amino acid. The > complicated part (I thought) here is creating a degenerate codon that > corresponds to either G or P. The way I will do this is by producing > each of the 3 degenerate bases and creating a new codon by creating each > of the 3 degenerate bases separately based on a 2D matrix which contains > the result of 'crossing' each of the nucleotide bases of the degenerate > code with each other. So when you cross the codon for G (GGN) with the > codon for P (CCN) you get a codon that contains the degeneracy of both > (SSN). So then you have a degenerate nucleotide sequence for your > peptide motif. > I have written this part already but I am wondering about the expand > function of Bio::Tools::SeqPattern . I'm not quite sure what it means by > the expanded sequence (if there is just one?) that it returns. I'm > trying to get every possible permutation of the motif is there any > function that does this or will I have to write one to parse it myself? > ..... > This would be great, but what would make things even better would be if > I could take multiple sequence alignments and produce patterns/motifs > from them. Is there a part of BioPerl that does something like this? > > Thanks, > > Sam > Correct me if I'm wrong (or if it's not relevant)... If you use the example above with G (GGN) and P (CCN) and combine to give SSN, wouldn't you also get everything that had an A (GCN) or a R (CGN) at that residue? -Sara Yes you would, G and P are a bit of a bad example that I randomly suggested, you might be more likely to be looking for something like a change in hydrophobic residue like V or A in which case your overall degenerate codon would be GYN. It's generally probably more effective when you are just looking for third base wobble, or other very similar codons. When you cross degenerate codons they do tend to approach maximum degeneracy (NNN) pretty quickly, so it's about picking the right amino acids from your consensus/pattern. Sam From cjfields at illinois.edu Tue Jan 13 12:28:07 2009 From: cjfields at illinois.edu (Chris Fields) Date: Tue, 13 Jan 2009 11:28:07 -0600 Subject: [Bioperl-l] About to tag the last RC... Message-ID: <306ED109-1E35-4769-A8AE-0FBB85EFAF7E@illinois.edu> All, I'm going to run one more RC round for bioperl before the final 1.6 release; there are some odd test failures on CPAN Testers I'm trying to rectify. I will probably tag/bag/release RC3 sometime this afternoon. Any complaints? Issues? Bugs? Haven't heard any feedback except from Sendu (which is a worry for a stable release). chris From cjfields at illinois.edu Tue Jan 13 13:41:57 2009 From: cjfields at illinois.edu (Chris Fields) Date: Tue, 13 Jan 2009 12:41:57 -0600 Subject: [Bioperl-l] Bio::Seq::SeqWithQuality status Message-ID: <2D0719BB-35B7-4D67-95E1-FD4AA5D83F3C@illinois.edu> What is the current status of this module? Florent Angly has marked this as deprecated on main trunk (in the POD) but it hasn't been added to the DEPRECATED list, nor can I find any discussion on the mail list about deprecating this module (normally a prerequisite for doing so). chris From David.Messina at sbc.su.se Tue Jan 13 13:49:03 2009 From: David.Messina at sbc.su.se (Dave Messina) Date: Tue, 13 Jan 2009 19:49:03 +0100 Subject: [Bioperl-l] About to tag the last RC... In-Reply-To: <306ED109-1E35-4769-A8AE-0FBB85EFAF7E@illinois.edu> References: <306ED109-1E35-4769-A8AE-0FBB85EFAF7E@illinois.edu> Message-ID: <628aabb70901131049n45286df3j43078dea745065a5@mail.gmail.com> Hey Chris, I just tested RC2 under a vanilla Perl 5.8.8 install on OS X 10.5.6. When I skip install of optional modules, BioPerl scripts, and network tests, everything goes fine. All tests successful, 58 tests and 319 subtests skipped. Files=320, Tests=14927, 121 wallclock secs (83.92 cusr + 13.91 csys = 97.83 CPU) However, when I request installation of all optional modules, all BioPerl scripts, and the network tests, I run into some minor problems. Note that I'm building and testing on the command line, not via the CPAN shell. Test output is below (minus the 'copying script' stuff at the beginning). Dave t/Align/AlignStats...........................ok t/Align/AlignUtil............................ok t/Align/SimpleAlign..........................ok t/Align/TreeBuild............................ok t/Align/Utilities............................ok t/AlignIO/AlignIO............................ok t/AlignIO/arp................................ok t/AlignIO/bl2seq.............................ok t/AlignIO/clustalw...........................ok t/AlignIO/emboss.............................ok t/AlignIO/fasta..............................ok t/AlignIO/largemultifasta....................ok t/AlignIO/maf................................ok t/AlignIO/mase...............................ok t/AlignIO/mega...............................ok t/AlignIO/meme...............................ok t/AlignIO/metafasta..........................ok t/AlignIO/msf................................ok t/AlignIO/nexus..............................ok t/AlignIO/pfam...............................ok t/AlignIO/phylip.............................ok t/AlignIO/po.................................ok t/AlignIO/prodom.............................ok t/AlignIO/psi................................ok t/AlignIO/selex..............................ok t/AlignIO/stockholm..........................ok t/AlignIO/xmfa...............................ok t/Alphabet...................................ok t/Annotation/Annotation......................1/155 # Failed (TODO) test 'The object isa Bio::Annotation::Comment' # in t/Annotation/Annotation.t at line 214. # The object isn't a 'Bio::Annotation::Comment' it's a 'Bio::Annotation::OntologyTerm' t/Annotation/Annotation......................ok t/Annotation/AnnotationAdaptor...............ok t/Assembly/Assembly..........................2/50 --------------------- WARNING --------------------- MSG: Adding non-nucleotidic sequence ML4922R --------------------------------------------------- --------------------- WARNING --------------------- MSG: Adding non-nucleotidic sequence ML4947F --------------------------------------------------- t/Assembly/Assembly..........................ok t/Assembly/ContigSpectrum....................ok t/Biblio/Biblio..............................ok t/Biblio/References..........................ok t/Biblio/biofetch............................ok t/Biblio/eutils..............................1/4 ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: Bio/DB/Biblio/eutils.pm: eutils cannot be found or loaded Exception Can't locate XML/Twig.pm in @INC (@INC contains: /Users/dave/.cpan/build/BioPerl-1.5.9._2 _build/lib t/lib . /Users/dave/.cpan/build/BioPerl-1.5.9._2/blib/lib /Users/dave/.cpan/build/BioPerl-1.5.9._2/blib/arch /Users/dave/src/bioperl-live /Users/dave/src/sonnh/dmess /System/Library/Perl/5.8.8/darwin-thread-multi-2level /System/Library/Perl/5.8.8 /Library/Perl/5.8.8/darwin-thread-multi-2level /Library/Perl/5.8.8 /Library/Perl /Network/Library/Perl/5.8.8/darwin-thread-multi-2level /Network/Library/Perl/5.8.8 /Network/Library/Perl /System/Library/Perl/Extras/5.8.8/darwin-thread-multi-2level /System/Library/Perl/Extras/5.8.8 /Library/Perl/5.8.6 /Library/Perl/5.8.1) at /Users/dave/.cpan/build/BioPerl-1.5.9._2/Bio/DB/Biblio/eutils.pm line 122. BEGIN failed--compilation aborted at /Users/dave/.cpan/build/BioPerl-1.5.9._2/Bio/DB/Biblio/eutils.pm line 122. Compilation failed in require at /Users/dave/.cpan/build/BioPerl-1.5.9._2/Bio/Biblio.pm line 315. For more information about the Biblio system please see the Bio::Biblio docs. STACK: Error::throw STACK: Bio::Root::Root::throw /Users/dave/.cpan/build/BioPerl-1.5.9._2/Bio/Root/Root.pm:357 STACK: Bio::Biblio::_load_access_module /Users/dave/.cpan/build/BioPerl-1.5.9._2/Bio/Biblio.pm:319 STACK: Bio::Biblio::new /Users/dave/.cpan/build/BioPerl-1.5.9._2/Bio/Biblio.pm:280 STACK: t/Biblio/eutils.t:22 ----------------------------------------------------------- # Looks like you planned 4 tests but only ran 1. t/Biblio/eutils.............................. Dubious, test returned 255 (wstat 65280, 0xff00) Failed 3/4 subtests t/ClusterIO/ClusterIO........................ok t/ClusterIO/SequenceFamily...................ok t/ClusterIO/unigene..........................ok t/Coordinate/CoordinateGraph.................ok t/Coordinate/CoordinateMapper................ok t/Coordinate/GeneCoordinateMapper............ok t/LiveSeq/Chain..............................ok t/LiveSeq/LiveSeq............................ok t/LiveSeq/Mutation...........................ok t/LiveSeq/Mutator............................ok t/LocalDB/BioDBGFF...........................ok t/LocalDB/BlastIndex.........................ok t/LocalDB/DBFasta............................ok t/LocalDB/DBQual.............................ok t/LocalDB/Flat...............................ok t/LocalDB/Index..............................ok t/LocalDB/Registry...........................ok t/LocalDB/SeqFeature.........................ok t/LocalDB/SeqFeature_BDB.....................ok t/LocalDB/transfac_pro.......................ok t/Map/Cyto...................................ok t/Map/Linkage................................ok t/Map/Map....................................ok t/Map/MapIO..................................ok t/Map/MicrosatelliteMarker...................ok t/Map/Physical...............................ok t/Matrix/IO/masta............................ok t/Matrix/IO/psm..............................ok t/Matrix/InstanceSite........................ok t/Matrix/Matrix..............................ok t/Matrix/ProtMatrix..........................ok t/Matrix/ProtPsm.............................ok t/Matrix/SiteMatrix..........................ok t/Ontology/GOterm............................skipped: The optional module Graph::Directed (or dependencies thereof) was not installed t/Ontology/GraphAdaptor......................skipped: The optional module Graph (or dependencies thereof) was not installed t/Ontology/IO/go.............................skipped: The optional module Graph (or dependencies thereof) was not installed t/Ontology/IO/interpro.......................skipped: The optional module XML::Parser::PerlSAX (or dependencies thereof) was not installed t/Ontology/IO/obo............................skipped: The optional module Graph (or dependencies thereof) was not installed t/Ontology/Ontology..........................skipped: The optional module Graph (or dependencies thereof) was not installed t/Ontology/OntologyEngine....................skipped: The optional module Graph::Directed (or dependencies thereof) was not installed t/Ontology/OntologyStore.....................skipped: The optional module Graph (or dependencies thereof) was not installed t/Ontology/Relationship......................skipped: The optional module Graph::Directed (or dependencies thereof) was not installed t/Ontology/RelationshipType..................skipped: The optional module Graph::Directed (or dependencies thereof) was not installed t/Ontology/Term..............................skipped: The optional module Graph::Directed (or dependencies thereof) was not installed t/Perl.......................................ok t/Phenotype/Correlate........................ok t/Phenotype/MeSH.............................ok t/Phenotype/Measure..........................ok t/Phenotype/MiniMIMentry.....................ok t/Phenotype/OMIMentry........................ok t/Phenotype/OMIMentryAllelicVariant..........ok t/Phenotype/OMIMparser.......................ok t/Phenotype/Phenotype........................ok t/PodSyntax..................................skipped: Test::Pod 1.00 required for testing POD t/PopGen/Coalescent..........................ok t/PopGen/HtSNP...............................ok t/PopGen/MK..................................ok t/PopGen/PopGen..............................ok t/PopGen/PopGenSims..........................ok t/PopGen/TagHaplotype........................ok t/RemoteDB/BioFetch..........................ok t/RemoteDB/CUTG..............................ok t/RemoteDB/DB................................104/116 # Failed test in t/RemoteDB/DB.t at line 352. # got: 'unknown' # expected: 'GDB:188393' t/RemoteDB/DB................................114/116 # Looks like you failed 1 test of 116. t/RemoteDB/DB................................ Dubious, test returned 1 (wstat 256, 0x100) Failed 1/116 subtests (less 8 skipped subtests: 107 okay) t/RemoteDB/EMBL..............................ok t/RemoteDB/EUtilities........................ok t/RemoteDB/GDB...............................2/12 # Failed test 'info was unknown' # in t/RemoteDB/GDB.t at line 40. # got: 'unknown' # expected: 'GDB:188296' # Failed test 'info was notfound' # in t/RemoteDB/GDB.t at line 41. # got: 'notfound' # expected: 'GCCCAGGAGGTTGAGG' # Failed test 'info was notfound' # in t/RemoteDB/GDB.t at line 42. # got: 'notfound' # expected: 'AAGGCAGGCTTGAATTACAG' Use of uninitialized value in concatenation (.) or string at t/RemoteDB/GDB.t line 43. # Failed test 'info was ' # in t/RemoteDB/GDB.t at line 43. # got: undef # expected: '226' t/RemoteDB/GDB...............................8/12 # Failed test 'info was unknown' # in t/RemoteDB/GDB.t at line 55. # got: 'unknown' # expected: 'GDB:198271' # Failed test 'info was notfound' # in t/RemoteDB/GDB.t at line 56. # got: 'notfound' # expected: 'GGGTGACAGAACAAGACCT' # Failed test 'info was notfound' # in t/RemoteDB/GDB.t at line 57. # got: 'notfound' # expected: 'ACCCATTAGCCTTGAACTGA' Use of uninitialized value in concatenation (.) or string at t/RemoteDB/GDB.t line 58. # Failed test 'info was ' # in t/RemoteDB/GDB.t at line 58. # got: undef # expected: '155' # Looks like you failed 8 tests of 12. t/RemoteDB/GDB............................... Dubious, test returned 8 (wstat 2048, 0x800) Failed 8/12 subtests t/RemoteDB/HIV/HIV...........................21/29 # Error: # ------------- EXCEPTION: Bio::WebError::Exception ------------- # MSG: Unparsed failure at /Users/dave/.cpan/build/BioPerl-1.5.9._2/blib/lib/Bio/DB/HIV.pm line 275. # # VALUE: An empty string ("") # STACK: Error::throw # STACK: Bio::Root::Root::throw /Users/dave/.cpan/build/BioPerl-1.5.9._2/blib/lib/Bio/Root/Root.pm:357 # STACK: Bio::DB::HIV::get_request /Users/dave/.cpan/build/BioPerl-1.5.9._2/blib/lib/Bio/DB/HIV.pm:277 # STACK: Bio::DB::HIV::get_seq_stream /Users/dave/.cpan/build/BioPerl-1.5.9._2/blib/lib/Bio/DB/HIV.pm:396 # STACK: Bio::DB::HIV::get_Stream_by_acc /Users/dave/.cpan/build/BioPerl-1.5.9._2/blib/lib/Bio/DB/HIV.pm:491 # STACK: t/RemoteDB/HIV/HIV.t:78 # --------------------------------------------------------------- t/RemoteDB/HIV/HIV...........................22/29 # Looks like you planned 29 tests but ran 1 extra. t/RemoteDB/HIV/HIV........................... Dubious, test returned 255 (wstat 65280, 0xff00) All 29 subtests passed (less 9 skipped subtests: 20 okay) t/RemoteDB/HIV/HIVAnnotProcessor.............ok t/RemoteDB/HIV/HIVQuery......................ok t/RemoteDB/HIV/HIVQueryHelper................ok t/RemoteDB/RefSeq............................ok t/RemoteDB/SeqHound..........................ok t/RemoteDB/SeqRead_fail......................ok t/RemoteDB/SeqVersion........................ok t/RemoteDB/Taxonomy..........................skipped: The optional module XML::Twig (or dependencies thereof) was not installed t/Restriction/Analysis.......................ok t/Restriction/Gel............................ok t/Restriction/IO.............................1/18 # Failed (TODO) test in t/Restriction/IO.t at line 31. t/Restriction/IO.............................ok t/Root/Exception.............................ok t/Root/RootI.................................ok t/Root/RootIO................................30/31 ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: request failed: HTTP/1.0 400 Bad Request STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:357 STACK: Bio::Root::HTTPget::getFH Bio/Root/HTTPget.pm:234 STACK: Bio::Root::IO::_initialize_io Bio/Root/IO.pm:279 STACK: Bio::Root::IO::new Bio/Root/IO.pm:223 STACK: t/Root/RootIO.t:107 ----------------------------------------------------------- # Looks like you planned 31 tests but only ran 30. t/Root/RootIO................................ Dubious, test returned 255 (wstat 65280, 0xff00) Failed 1/31 subtests t/Root/Storable..............................ok t/Root/Tempfile..............................ok t/Root/Utilities.............................ok t/SearchDist.................................skipped: The optional module Bio::Ext::Align (or dependencies thereof) was not installed t/SearchIO/CigarString.......................ok t/SearchIO/GbrowseGFF........................ok t/SearchIO/SearchIO..........................ok t/SearchIO/SimilarityPair....................ok t/SearchIO/Writer/HTMLWriter.................ok t/SearchIO/Writer/HitTableWriter.............ok t/SearchIO/blast.............................2/1091 # Failed (TODO) test in t/SearchIO/blast.t at line 527. # '0.852' # > # '0.9' # Failed (TODO) test in t/SearchIO/blast.t at line 528. # '1.599' # <= # '1' t/SearchIO/blast.............................ok t/SearchIO/blast_pull........................10/289 # Failed (TODO) test in t/SearchIO/blast_pull.t at line 260. # got: '0.946' # expected: '0.943' t/SearchIO/blast_pull........................ok t/SearchIO/blasttable........................ok t/SearchIO/blastxml..........................1/298 # Failed (TODO) test in t/SearchIO/blastxml.t at line 254. # got: undef # expected: '31984247' # Failed (TODO) test in t/SearchIO/blastxml.t at line 255. # got: undef # expected: '88780' # Failed (TODO) test in t/SearchIO/blastxml.t at line 256. # got: undef # expected: '49' t/SearchIO/blastxml..........................ok t/SearchIO/cross_match.......................ok t/SearchIO/erpin.............................ok t/SearchIO/exonerate.........................ok t/SearchIO/fasta.............................ok t/SearchIO/hmmer.............................ok t/SearchIO/hmmer_pull........................ok t/SearchIO/infernal..........................ok t/SearchIO/megablast.........................ok t/SearchIO/psl...............................ok t/SearchIO/rnamotif..........................ok t/SearchIO/sim4..............................ok t/SearchIO/waba..............................ok t/SearchIO/wise..............................ok t/Seq/DBLink.................................ok t/Seq/EncodedSeq.............................ok t/Seq/LargeLocatableSeq......................ok t/Seq/LargePSeq..............................ok t/Seq/LocatableSeq...........................1/116 # Failed (TODO) test in t/Seq/LocatableSeq.t at line 45. # got: 'Bio::Location::Simple=HASH(0x812a74)' # expected: undef # Failed (TODO) test in t/Seq/LocatableSeq.t at line 284. # got: '\-\.=~' # expected: '-\?' # Failed (TODO) test in t/Seq/LocatableSeq.t at line 286. # '19' # ne # '19' t/Seq/LocatableSeq...........................ok t/Seq/MetaSeq................................ok t/Seq/PrimaryQual............................ok t/Seq/PrimarySeq.............................ok t/Seq/PrimedSeq..............................ok t/Seq/Quality................................ok t/Seq/Seq....................................ok t/Seq/WithQuality............................ok t/SeqEvolution...............................ok t/SeqFeature/FeatureIO.......................skipped: The optional module Graph (or dependencies thereof) was not installed t/SeqFeature/Location........................ok t/SeqFeature/LocationFactory.................ok t/SeqFeature/Primer..........................ok t/SeqFeature/Range...........................ok t/SeqFeature/RangeI..........................ok t/SeqFeature/SeqAnalysisParser...............ok t/SeqFeature/SeqFeatAnnotated................skipped: The optional module Graph::Directed (or dependencies thereof) was not installed t/SeqFeature/SeqFeatCollection...............ok t/SeqFeature/SeqFeature......................ok t/SeqFeature/SeqFeaturePrimer................ok t/SeqFeature/Unflattener.....................ok t/SeqFeature/Unflattener2....................ok t/SeqIO......................................ok t/SeqIO/Handler..............................ok t/SeqIO/MultiFile............................ok t/SeqIO/Multiple_fasta.......................ok t/SeqIO/SeqBuilder...........................ok t/SeqIO/Splicedseq...........................ok t/SeqIO/abi..................................skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed t/SeqIO/ace..................................ok t/SeqIO/agave................................ok t/SeqIO/alf..................................ok t/SeqIO/asciitree............................ok t/SeqIO/bsml.................................skipped: The optional module XML::DOM (or dependencies thereof) was not installed t/SeqIO/bsml_sax.............................skipped: The optional module XML::SAX::Writer (or dependencies thereof) was not installed t/SeqIO/chadoxml.............................ok t/SeqIO/chaos................................ok t/SeqIO/chaosxml.............................ok t/SeqIO/ctf..................................skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed t/SeqIO/embl.................................ok t/SeqIO/entrezgene...........................skipped: The optional module Bio::ASN1::EntrezGene (or dependencies thereof) was not installed t/SeqIO/excel................................skipped: The optional module Spreadsheet::ParseExcel (or dependencies thereof) was not installed t/SeqIO/exp..................................skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed t/SeqIO/fasta................................ok t/SeqIO/fastq................................ok t/SeqIO/flybase_chadoxml.....................ok t/SeqIO/game.................................skipped: The optional module XML::Parser::PerlSAX (or dependencies thereof) was not installed t/SeqIO/gcg..................................1/17 # Failed (TODO) test 'primary_id' # in t/SeqIO/gcg.t at line 54. # got: 'Bio::PrimarySeq=HASH(0x9374bc)' # expected: 'roa1_drome' t/SeqIO/gcg..................................ok t/SeqIO/genbank..............................ok t/SeqIO/interpro.............................skipped: The optional module XML::DOM::XPath (or dependencies thereof) was not installed t/SeqIO/kegg.................................ok t/SeqIO/largefasta...........................ok t/SeqIO/lasergene............................ok t/SeqIO/locuslink............................skipped: The optional module Graph::Directed (or dependencies thereof) was not installed t/SeqIO/metafasta............................ok t/SeqIO/phd..................................ok t/SeqIO/pir..................................ok t/SeqIO/pln..................................skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed t/SeqIO/qual.................................ok t/SeqIO/raw..................................ok t/SeqIO/scf..................................1/59 # Failed (TODO) test 'accuracies' # in t/SeqIO/scf.t at line 78. # got: 'ARRAY(0x989ba0)' # expected: '482' t/SeqIO/scf..................................ok t/SeqIO/strider..............................skipped: The optional module Convert::Binary::C (or dependencies thereof) was not installed t/SeqIO/swiss................................ok t/SeqIO/tab..................................ok t/SeqIO/table................................ok t/SeqIO/tigr.................................ok t/SeqIO/tigrxml..............................skipped: The optional module XML::SAX::Writer (or dependencies thereof) was not installed t/SeqIO/tinyseq..............................skipped: The optional module XML::Parser::PerlSAX (or dependencies thereof) was not installed t/SeqIO/ztr..................................skipped: The optional module Bio::SeqIO::staden::read (or dependencies thereof) was not installed t/SeqTools/CodonTable........................ok t/SeqTools/ECnumber..........................ok t/SeqTools/GuessSeqFormat....................ok t/SeqTools/OddCodes..........................ok t/SeqTools/SeqPattern........................ok t/SeqTools/SeqStats..........................ok t/SeqTools/SeqUtils..........................ok t/SeqTools/SeqWords..........................ok t/Species....................................ok t/Structure/IO...............................ok t/Structure/Structure........................ok t/Symbol.....................................ok t/TaxonTree..................................skipped: All tests are being skipped, probably because the module(s) being tested here are now deprecated t/Tools/Alignment/Consed.....................ok t/Tools/Analysis/DNA/ESEfinder...............ok t/Tools/Analysis/Protein/Domcut..............ok t/Tools/Analysis/Protein/ELM.................ok t/Tools/Analysis/Protein/GOR4................ok t/Tools/Analysis/Protein/HNN.................ok t/Tools/Analysis/Protein/Mitoprot............ok t/Tools/Analysis/Protein/NetPhos.............ok t/Tools/Analysis/Protein/Scansite............ok t/Tools/Analysis/Protein/Sopma...............ok t/Tools/EMBOSS/Palindrome....................ok t/Tools/EUtilities/EUtilParameters...........ok t/Tools/EUtilities/egquery...................ok t/Tools/EUtilities/einfo.....................ok t/Tools/EUtilities/elink_acheck..............ok t/Tools/EUtilities/elink_lcheck..............ok t/Tools/EUtilities/elink_llinks..............ok t/Tools/EUtilities/elink_ncheck..............ok t/Tools/EUtilities/elink_neighbor............ok t/Tools/EUtilities/elink_neighbor_history....ok t/Tools/EUtilities/elink_scores..............ok t/Tools/EUtilities/epost.....................ok t/Tools/EUtilities/esearch...................ok t/Tools/EUtilities/espell....................ok t/Tools/EUtilities/esummary..................ok t/Tools/Est2Genome...........................ok t/Tools/FootPrinter..........................ok t/Tools/GFF..................................ok t/Tools/Geneid...............................ok t/Tools/Genewise.............................ok t/Tools/Genomewise...........................ok t/Tools/Genpred..............................ok t/Tools/Hmmer................................ok t/Tools/IUPAC................................ok t/Tools/Lucy.................................ok t/Tools/Match................................ok t/Tools/Phylo/Gerp...........................ok t/Tools/Phylo/Molphy.........................ok t/Tools/Phylo/PAML...........................ok t/Tools/Phylo/Phylip/ProtDist................ok t/Tools/Primer3..............................skipped: The optional module Clone (or dependencies thereof) was not installed t/Tools/Promoterwise.........................ok t/Tools/Pseudowise...........................ok t/Tools/QRNA.................................ok t/Tools/RandDistFunctions....................ok t/Tools/RepeatMasker.........................ok t/Tools/Run/RemoteBlast......................ok t/Tools/Run/StandAloneBlast..................ok t/Tools/Run/WrapperBase......................ok t/Tools/Seg..................................ok t/Tools/SiRNA................................ok t/Tools/Sigcleave............................ok t/Tools/Signalp..............................ok t/Tools/Signalp/ExtendedSignalp..............ok t/Tools/Sim4.................................ok t/Tools/Spidey/Spidey........................ok t/Tools/TandemRepeatsFinder..................ok t/Tools/TargetP..............................ok t/Tools/Tmhmm................................ok t/Tools/ePCR.................................ok t/Tools/pICalculator.........................ok t/Tools/rnamotif.............................skipped: All tests are being skipped, probably because the module(s) being tested here are now deprecated t/Tools/tRNAscanSE...........................ok t/Tree/Compatible............................skipped: The optional module Set::Scalar (or dependencies thereof) was not installed t/Tree/Node..................................ok t/Tree/PhyloNetwork/Factory..................skipped: The optional module Bio::PhyloNetwork (or dependencies thereof) was not installed t/Tree/PhyloNetwork/GraphViz.................skipped: The optional module Bio::PhyloNetwork (or dependencies thereof) was not installed t/Tree/PhyloNetwork/MuVector.................ok t/Tree/PhyloNetwork/PhyloNetwork.............skipped: The optional module Graph::Directed (or dependencies thereof) was not installed t/Tree/PhyloNetwork/RandomFactory............skipped: The optional module Bio::PhyloNetwork (or dependencies thereof) was not installed t/Tree/PhyloNetwork/TreeFactory..............skipped: The optional module Bio::PhyloNetwork (or dependencies thereof) was not installed t/Tree/RandomTreeFactory.....................ok t/Tree/Tree..................................ok t/Tree/TreeIO................................ok t/Tree/TreeIO/lintree........................ok t/Tree/TreeIO/newick.........................ok t/Tree/TreeIO/nexus..........................ok t/Tree/TreeIO/nhx............................ok t/Tree/TreeIO/phyloxml.......................skipped: The optional module XML::LibXML::Reader (or dependencies thereof) was not installed t/Tree/TreeIO/svggraph.......................ok t/Tree/TreeIO/tabtree........................ok t/Tree/TreeStatistics........................ok t/Variation/AAChange.........................ok t/Variation/AAReverseMutate..................ok t/Variation/Allele...........................ok t/Variation/DNAMutation......................ok t/Variation/RNAChange........................ok t/Variation/SNP..............................ok t/Variation/SeqDiff..........................ok t/Variation/Variation_IO.....................ok Test Summary Report ------------------- t/Biblio/eutils (Wstat: 65280 Tests: 1 Failed: 0) Non-zero exit status: 255 Parse errors: Bad plan. You planned 4 tests but ran 1. t/RemoteDB/DB (Wstat: 256 Tests: 116 Failed: 1) Failed test: 104 Non-zero exit status: 1 t/RemoteDB/GDB (Wstat: 2048 Tests: 12 Failed: 8) Failed tests: 4-7, 9-12 Non-zero exit status: 8 t/RemoteDB/HIV/HIV (Wstat: 65280 Tests: 30 Failed: 1) Failed test: 30 Non-zero exit status: 255 Parse errors: Bad plan. You planned 29 tests but ran 30. t/Root/RootIO (Wstat: 65280 Tests: 30 Failed: 0) Non-zero exit status: 255 Parse errors: Bad plan. You planned 31 tests but ran 30. Files=320, Tests=15582, 408 wallclock secs ( 3.22 usr 1.69 sys + 87.89 cusr 14.18 csys = 106.98 CPU) Result: FAIL Failed 5/320 test programs. 10/15582 subtests failed. 91.424u 16.019s 6:48.97 26.2% 0+0k 1+716io 0pf+0w Exit 255 From cjfields at illinois.edu Tue Jan 13 14:18:59 2009 From: cjfields at illinois.edu (Chris Fields) Date: Tue, 13 Jan 2009 13:18:59 -0600 Subject: [Bioperl-l] About to tag the last RC... In-Reply-To: <628aabb70901131049n45286df3j43078dea745065a5@mail.gmail.com> References: <306ED109-1E35-4769-A8AE-0FBB85EFAF7E@illinois.edu> <628aabb70901131049n45286df3j43078dea745065a5@mail.gmail.com> Message-ID: On Jan 13, 2009, at 12:49 PM, Dave Messina wrote: > Hey Chris, > I just tested RC2 under a vanilla Perl 5.8.8 install on OS X 10.5.6. > > When I skip install of optional modules, BioPerl scripts, and > network tests, > everything goes fine. > > All tests successful, 58 tests and 319 subtests skipped. > Files=320, Tests=14927, 121 wallclock secs (83.92 cusr + 13.91 csys > = 97.83 > CPU) > > > However, when I request installation of all optional modules, all > BioPerl > scripts, and the network tests, I run into some minor problems. Note > that > I'm building and testing on the command line, not via the CPAN shell. > > Test output is below (minus the 'copying script' stuff at the > beginning). > > Dave > > ... > t/Biblio/eutils..............................1/4 > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: Bio/DB/Biblio/eutils.pm: eutils cannot be found or loaded > Exception Can't locate XML/Twig.pm in @INC (@INC contains: > /Users/dave/.cpan/build/BioPerl-1.5.9._2 _build/lib t/lib . > /Users/dave/.cpan/build/BioPerl-1.5.9._2/blib/lib > /Users/dave/.cpan/build/BioPerl-1.5.9._2/blib/arch > /Users/dave/src/bioperl-live /Users/dave/src/sonnh/dmess > /System/Library/Perl/5.8.8/darwin-thread-multi-2level > /System/Library/Perl/5.8.8 /Library/Perl/5.8.8/darwin-thread- > multi-2level > /Library/Perl/5.8.8 /Library/Perl > /Network/Library/Perl/5.8.8/darwin-thread-multi-2level > /Network/Library/Perl/5.8.8 /Network/Library/Perl > /System/Library/Perl/Extras/5.8.8/darwin-thread-multi-2level > /System/Library/Perl/Extras/5.8.8 /Library/Perl/5.8.6 /Library/Perl/ > 5.8.1) > at /Users/dave/.cpan/build/BioPerl-1.5.9._2/Bio/DB/Biblio/eutils.pm > line > 122. > BEGIN failed--compilation aborted at > /Users/dave/.cpan/build/BioPerl-1.5.9._2/Bio/DB/Biblio/eutils.pm > line 122. > Compilation failed in require at > /Users/dave/.cpan/build/BioPerl-1.5.9._2/Bio/Biblio.pm line 315. > > For more information about the Biblio system please see the > Bio::Biblio > docs. > > STACK: Error::throw > STACK: Bio::Root::Root::throw > /Users/dave/.cpan/build/BioPerl-1.5.9._2/Bio/Root/Root.pm:357 > STACK: Bio::Biblio::_load_access_module > /Users/dave/.cpan/build/BioPerl-1.5.9._2/Bio/Biblio.pm:319 > STACK: Bio::Biblio::new > /Users/dave/.cpan/build/BioPerl-1.5.9._2/Bio/Biblio.pm:280 > STACK: t/Biblio/eutils.t:22 > ----------------------------------------------------------- > # Looks like you planned 4 tests but only ran 1. > t/Biblio/eutils.............................. Dubious, test returned > 255 > (wstat 65280, 0xff00) > Failed 3/4 subtests Fixed on main trunk (missing a dependency). > t/RemoteDB/DB................................104/116 > # Failed test in t/RemoteDB/DB.t at line 352. > # got: 'unknown' > # expected: 'GDB:188393' > t/RemoteDB/DB................................114/116 # Looks like > you failed > 1 test of 116. > t/RemoteDB/DB................................ Dubious, test returned 1 > (wstat 256, 0x100) > Failed 1/116 subtests > (less 8 skipped subtests: 107 okay) ... > t/RemoteDB/GDB...............................2/12 > # Failed test 'info was unknown' > # in t/RemoteDB/GDB.t at line 40. > # got: 'unknown' > # expected: 'GDB:188296' > ... > Failed 8/12 subtests These pass for me but skips the GDB tests due to lack of server connection. The server does indeed appear to be down. I thought GDB was supposed to be maintained by ORNL past July 31? If it is indeed down for good we'll need to (unfortunately) deprecate this module. There is an article about that here: http://www.sciencemag.org/cgi/content/full/279/5357/1611d?ck=nck (req. subscription) http://en.wikipedia.org/wiki/GDB_Human_Genome_Database > t/RemoteDB/HIV/HIV...........................21/29 # Error: > # ------------- EXCEPTION: Bio::WebError::Exception ------------- > # MSG: Unparsed failure at > /Users/dave/.cpan/build/BioPerl-1.5.9._2/blib/lib/Bio/DB/HIV.pm line > 275. > # > # VALUE: An empty string ("") > # STACK: Error::throw > # STACK: Bio::Root::Root::throw > /Users/dave/.cpan/build/BioPerl-1.5.9._2/blib/lib/Bio/Root/Root.pm:357 > # STACK: Bio::DB::HIV::get_request > /Users/dave/.cpan/build/BioPerl-1.5.9._2/blib/lib/Bio/DB/HIV.pm:277 > # STACK: Bio::DB::HIV::get_seq_stream > /Users/dave/.cpan/build/BioPerl-1.5.9._2/blib/lib/Bio/DB/HIV.pm:396 > # STACK: Bio::DB::HIV::get_Stream_by_acc > /Users/dave/.cpan/build/BioPerl-1.5.9._2/blib/lib/Bio/DB/HIV.pm:491 > # STACK: t/RemoteDB/HIV/HIV.t:78 > # --------------------------------------------------------------- > t/RemoteDB/HIV/HIV...........................22/29 # Looks like you > planned > 29 tests but ran 1 extra. > t/RemoteDB/HIV/HIV........................... Dubious, test returned > 255 > (wstat 65280, 0xff00) > All 29 subtests passed > (less 9 skipped subtests: 20 okay) Test count can off when batch-eval tests. Fixed on main trunk. > t/Root/RootIO................................30/31 > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: request failed: HTTP/1.0 400 Bad Request > STACK: Error::throw > STACK: Bio::Root::Root::throw Bio/Root/Root.pm:357 > STACK: Bio::Root::HTTPget::getFH Bio/Root/HTTPget.pm:234 > STACK: Bio::Root::IO::_initialize_io Bio/Root/IO.pm:279 > STACK: Bio::Root::IO::new Bio/Root/IO.pm:223 > STACK: t/Root/RootIO.t:107 > ----------------------------------------------------------- > # Looks like you planned 31 tests but only ran 30. > t/Root/RootIO................................ Dubious, test returned > 255 > (wstat 65280, 0xff00) > Failed 1/31 subtests Odd one, will have to look into that; it may be a problem specifically with using Bio::Root::HTTPget (I think this defaults to LWP if it is installed). Thanks for the tests! chris From florent.angly at gmail.com Tue Jan 13 14:37:12 2009 From: florent.angly at gmail.com (Florent Angly) Date: Tue, 13 Jan 2009 11:37:12 -0800 Subject: [Bioperl-l] Bio::Seq::SeqWithQuality status In-Reply-To: <2D0719BB-35B7-4D67-95E1-FD4AA5D83F3C@illinois.edu> References: <2D0719BB-35B7-4D67-95E1-FD4AA5D83F3C@illinois.edu> Message-ID: <496CED68.5050600@gmail.com> There is a line in the Bio::Seq::SeqWithQuality code that causes this module to display a warning mentioning that the module is deprecated: l. 231: $self->deprecated("deprecated class - use Bio::Seq::Quality instead"); I just updated the documentation so that is is clearer to everyone (incl. me). Florent Chris Fields wrote: > What is the current status of this module? Florent Angly has marked > this as deprecated on main trunk (in the POD) but it hasn't been added > to the DEPRECATED list, nor can I find any discussion on the mail list > about deprecating this module (normally a prerequisite for doing so). > > chris > From florent.angly at gmail.com Tue Jan 13 14:39:36 2009 From: florent.angly at gmail.com (Florent Angly) Date: Tue, 13 Jan 2009 11:39:36 -0800 Subject: [Bioperl-l] Bio::Seq::SeqWithQuality status In-Reply-To: <2D0719BB-35B7-4D67-95E1-FD4AA5D83F3C@illinois.edu> References: <2D0719BB-35B7-4D67-95E1-FD4AA5D83F3C@illinois.edu> Message-ID: <496CEDF8.4010905@gmail.com> There is some text in Bio::Seq::Quality that may explain why someone marked it as DEPRECATED in the first place: > DESCRIPTION > > This object stores base quality values together with the sequence > string. > > It is a reimplementation of Chad Matsalla's Bio::Seq::SeqWithQuality > module using Bio::Seq::MetaI. > > The implementation is based on Bio::Seq::Meta::Array. qual() and > trace() are base methods to store and retrieve information that have > extensions to retrieve values as a scalar (e.g. qual_text() ), or get > or set subvalues (e.g. subqual() ). See L for more > details. > > All the functional code is in Bio::Seq::Meta::Array. > > There deprecated methods that are included for compatibility with > Bio::Seq::SeqWithQuality. These will print a warning unless verbosity > of the object is set to be less than zero. > > Differences from Bio::Seq::SeqWithQuality > > It is not possible to fully follow the interface of > Bio::Seq::SeqWithQuality since internally a Bio::Seq::SeqWithQuality > object is a composite of two independent objects: a Bio::PrimarySeq > object and Bio::Seq::PrimaryQual object. Both of these objects can be > created separately and merged into Bio::Seq::SeqWithQuality. > > This implementation is based on Bio::Seq::Meta::Array that is a subclass > of Bio::PrimarySeq that stores any number of meta information in > unnamed arrays. > > Here we assume that two meta sets, called 'qual' and 'trace_indices' are > attached to a sequence. (But there is nothing that prevents you to add > as many named meta sets as you need using normal meta() methods). > > qual() is an alias to meta(), qualat($loc) is an alias to > submeta($loc,$loc). > > trace_indices() in Bio::Seq::SeqWithQuality has been abbreviated to > trace() and is an alias to named_meta('trace'). > > You can create an object without passing any arguments to the > constructor (Bio::Seq::SeqWithQuality fails without alphabet). It will > warn about not being able to set alphabet unless you set verbosity of > the object to a negative value. > > After the latest rewrite, the meta information sets (quality and > trace) no longer cover all the residues automatically. Methods to > check the length of meta information (L, > L)and to see if the ends are flushed to the sequence > have been added (L, L). To force > the old functinality, set L to true. > > qual_obj() and seq_obj() methods do not exist! > > Finally, there is only one set of descriptors (primary_id, display_id, > accession_number) for the object. Chris Fields wrote: > What is the current status of this module? Florent Angly has marked > this as deprecated on main trunk (in the POD) but it hasn't been added > to the DEPRECATED list, nor can I find any discussion on the mail list > about deprecating this module (normally a prerequisite for doing so). > > chris > From David.Messina at sbc.su.se Tue Jan 13 15:42:28 2009 From: David.Messina at sbc.su.se (Dave Messina) Date: Tue, 13 Jan 2009 21:42:28 +0100 Subject: [Bioperl-l] About to tag the last RC... In-Reply-To: References: <306ED109-1E35-4769-A8AE-0FBB85EFAF7E@illinois.edu> <628aabb70901131049n45286df3j43078dea745065a5@mail.gmail.com> Message-ID: <628aabb70901131242o24868785m73462b7742fefa5f@mail.gmail.com> Grabbed the trunk and tried again. This time, missing dependencies were correctly fetched and installed. I'm still getting the HIV error: t/RemoteDB/HIV/HIV...........................23/30 # Failed test 'get HXB2 in a stream by accession' # in t/RemoteDB/HIV/HIV.t at line 79. # died: Bio::WebError::Exception ( # ------------- EXCEPTION: Bio::WebError::Exception ------------- # MSG: Unparsed failure at /Users/dave/src/bioperl-live/blib/lib/Bio/DB/HIV.pm line 275. # # VALUE: An empty string ("") # STACK: Error::throw # STACK: Bio::Root::Root::throw /Users/dave/src/bioperl-live/blib/lib/Bio/Root/Root.pm:357 # STACK: Bio::DB::HIV::get_request /Users/dave/src/bioperl-live/blib/lib/Bio/DB/HIV.pm:277 # STACK: Bio::DB::HIV::get_seq_stream /Users/dave/src/bioperl-live/blib/lib/Bio/DB/HIV.pm:396 # STACK: Bio::DB::HIV::get_Stream_by_acc /Users/dave/src/bioperl-live/blib/lib/Bio/DB/HIV.pm:491 # STACK: Test::Exception::lives_ok t/RemoteDB/HIV/HIV.t:79 # STACK: t/RemoteDB/HIV/HIV.t:79 # --------------------------------------------------------------- # ) # Looks like you failed 1 test of 30. t/RemoteDB/HIV/HIV........................... Dubious, test returned 1 (wstat 256, 0x100) Failed 1/30 subtests (less 7 skipped subtests: 22 okay) I also got a new warning, even though the test passed: t/Tree/TreeIO/svggraph.......................1/4 Use of uninitialized value in join or string at /Library/Perl/5.8.8/SVG/Element.pm line 1195, line 1. t/Tree/TreeIO/svggraph.......................ok And then finally, check out the SeqFeature test parse errors in the summary: Test Summary Report ------------------- t/RemoteDB/DB (Wstat: 256 Tests: 116 Failed: 1) Failed test: 104 Non-zero exit status: 1 t/RemoteDB/GDB (Wstat: 2048 Tests: 12 Failed: 8) Failed tests: 4-7, 9-12 Non-zero exit status: 8 t/RemoteDB/HIV/HIV (Wstat: 256 Tests: 30 Failed: 1) Failed test: 23 Non-zero exit status: 1 t/Root/RootIO (Wstat: 65280 Tests: 30 Failed: 0) Non-zero exit status: 255 Parse errors: Bad plan. You planned 31 tests but ran 30. t/SeqFeature/SeqFeature (Wstat: 0 Tests: 350 Failed: 136) Failed tests: 85-209, 209-210, 210-211, 211-212, 212-213 213-214, 214 Parse errors: Tests out of sequence. Found (79) but expected (81) Tests out of sequence. Found (80) but expected (82) Tests out of sequence. Found (81) but expected (83) Tests out of sequence. Found (82) but expected (84) Tests out of sequence. Found (83) but expected (85) Displayed the first 5 of 271 TAP syntax errors. Re-run prove with the -p option to see them all. Files=322, Tests=16672, 567 wallclock secs ( 3.70 usr 2.11 sys + 112.37 cusr 17.65 csys = 135.83 CPU) Result: FAIL Failed 5/322 test programs. 146/16672 subtests failed. 116.460u 20.044s 9:28.64 24.0% 0+0k 22+957io 2pf+0w Exit 255 All the SeqFeature tests passed; I wonder if the temporary 404 glitch was responsible: t/SeqFeature/FeatureIO.......................ok t/SeqFeature/Location........................ok t/SeqFeature/LocationFactory.................ok t/SeqFeature/Primer..........................ok t/SeqFeature/Range...........................ok t/SeqFeature/RangeI..........................ok t/SeqFeature/SeqAnalysisParser...............ok t/SeqFeature/SeqFeatAnnotated................1/34 --------------------- WARNING --------------------- MSG: [1/5] tried to fetch http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo?rev=HEAD, but server threw 404. retrying... --------------------------------------------------- t/SeqFeature/SeqFeatAnnotated................ok t/SeqFeature/SeqFeatCollection...............ok t/SeqFeature/SeqFeature...................... All 214 subtests passed t/SeqFeature/SeqFeaturePrimer................ok t/SeqFeature/Unflattener.....................ok t/SeqFeature/Unflattener2....................ok Dave From cjfields at illinois.edu Tue Jan 13 19:31:49 2009 From: cjfields at illinois.edu (Chris Fields) Date: Tue, 13 Jan 2009 18:31:49 -0600 Subject: [Bioperl-l] Bio::Seq::SeqWithQuality status In-Reply-To: <496CED68.5050600@gmail.com> References: <2D0719BB-35B7-4D67-95E1-FD4AA5D83F3C@illinois.edu> <496CED68.5050600@gmail.com> Message-ID: <50C1E481-B3AF-449F-B085-5121B26D521E@illinois.edu> Florent, Okay, but that still doesn't answer the more significant question, mainly why this wasn't added to the appropriate file when the deprecation warning was added. And when are we supposed to remove the module (now? 1.7?). Looks like Heikki added the deprecation warning with r9002 (7/11/2005) which predates 1.5.1. We can remove it now but I think it's probably best to wait until 1.7 since we're almost 3 RCs into a release. chris On Jan 13, 2009, at 1:37 PM, Florent Angly wrote: > There is a line in the Bio::Seq::SeqWithQuality code that causes > this module to display a warning mentioning that the module is > deprecated: > > l. 231: $self->deprecated("deprecated class - use > Bio::Seq::Quality instead"); > > I just updated the documentation so that is is clearer to everyone > (incl. me). > > Florent > > Chris Fields wrote: >> What is the current status of this module? Florent Angly has >> marked this as deprecated on main trunk (in the POD) but it hasn't >> been added to the DEPRECATED list, nor can I find any discussion on >> the mail list about deprecating this module (normally a >> prerequisite for doing so). >> >> chris >> > From cjfields at illinois.edu Tue Jan 13 19:36:43 2009 From: cjfields at illinois.edu (Chris Fields) Date: Tue, 13 Jan 2009 18:36:43 -0600 Subject: [Bioperl-l] About to tag the last RC... In-Reply-To: <628aabb70901131242o24868785m73462b7742fefa5f@mail.gmail.com> References: <306ED109-1E35-4769-A8AE-0FBB85EFAF7E@illinois.edu> <628aabb70901131049n45286df3j43078dea745065a5@mail.gmail.com> <628aabb70901131242o24868785m73462b7742fefa5f@mail.gmail.com> Message-ID: <891D6E07-3C81-4E47-9F9A-45A5C5EAD6C8@illinois.edu> I notified Mark about the failed HIV test, but it appears to be sporadically failing and is likely a server-side issue. The svggraph.t is a warning that I think emanates from SVG::Graph, not a release killer but would be nice to get rid of. I'll look through it, and if it isn't fixable on our end I'll notify Allen Day. chris On Jan 13, 2009, at 2:42 PM, Dave Messina wrote: > Grabbed the trunk and tried again. > > This time, missing dependencies were correctly fetched and installed. > > I'm still getting the HIV error: > > t/RemoteDB/HIV/HIV...........................23/30 > # Failed test 'get HXB2 in a stream by accession' > # in t/RemoteDB/HIV/HIV.t at line 79. > # died: Bio::WebError::Exception ( > # ------------- EXCEPTION: Bio::WebError::Exception ------------- > # MSG: Unparsed failure at > /Users/dave/src/bioperl-live/blib/lib/Bio/DB/HIV.pm line 275. > # > # VALUE: An empty string ("") > # STACK: Error::throw > # STACK: Bio::Root::Root::throw > /Users/dave/src/bioperl-live/blib/lib/Bio/Root/Root.pm:357 > # STACK: Bio::DB::HIV::get_request > /Users/dave/src/bioperl-live/blib/lib/Bio/DB/HIV.pm:277 > # STACK: Bio::DB::HIV::get_seq_stream > /Users/dave/src/bioperl-live/blib/lib/Bio/DB/HIV.pm:396 > # STACK: Bio::DB::HIV::get_Stream_by_acc > /Users/dave/src/bioperl-live/blib/lib/Bio/DB/HIV.pm:491 > # STACK: Test::Exception::lives_ok t/RemoteDB/HIV/HIV.t:79 > # STACK: t/RemoteDB/HIV/HIV.t:79 > # --------------------------------------------------------------- > # ) > # Looks like you failed 1 test of 30. > t/RemoteDB/HIV/HIV........................... Dubious, test returned 1 > (wstat 256, 0x100) > Failed 1/30 subtests > (less 7 skipped subtests: 22 okay) > > > I also got a new warning, even though the test passed: > > t/Tree/TreeIO/svggraph.......................1/4 Use of > uninitialized value > in join or string at /Library/Perl/5.8.8/SVG/Element.pm line 1195, > > line 1. > t/Tree/TreeIO/svggraph.......................ok > > > > And then finally, check out the SeqFeature test parse errors in the > summary: > > Test Summary Report > ------------------- > t/RemoteDB/DB (Wstat: 256 Tests: 116 > Failed: 1) > Failed test: 104 > Non-zero exit status: 1 > t/RemoteDB/GDB (Wstat: 2048 Tests: 12 > Failed: 8) > Failed tests: 4-7, 9-12 > Non-zero exit status: 8 > t/RemoteDB/HIV/HIV (Wstat: 256 Tests: 30 > Failed: 1) > Failed test: 23 > Non-zero exit status: 1 > t/Root/RootIO (Wstat: 65280 Tests: 30 > Failed: 0) > Non-zero exit status: 255 > Parse errors: Bad plan. You planned 31 tests but ran 30. > t/SeqFeature/SeqFeature (Wstat: 0 Tests: 350 > Failed: 136) > Failed tests: 85-209, 209-210, 210-211, 211-212, 212-213 > 213-214, 214 > Parse errors: Tests out of sequence. Found (79) but expected (81) > Tests out of sequence. Found (80) but expected (82) > Tests out of sequence. Found (81) but expected (83) > Tests out of sequence. Found (82) but expected (84) > Tests out of sequence. Found (83) but expected (85) > Displayed the first 5 of 271 TAP syntax errors. > Re-run prove with the -p option to see them all. > Files=322, Tests=16672, 567 wallclock secs ( 3.70 usr 2.11 sys + > 112.37 > cusr 17.65 csys = 135.83 CPU) > Result: FAIL > Failed 5/322 test programs. 146/16672 subtests failed. > 116.460u 20.044s 9:28.64 24.0% 0+0k 22+957io 2pf+0w > Exit 255 > > > All the SeqFeature tests passed; I wonder if the temporary 404 > glitch was > responsible: > > t/SeqFeature/FeatureIO.......................ok > t/SeqFeature/Location........................ok > t/SeqFeature/LocationFactory.................ok > t/SeqFeature/Primer..........................ok > t/SeqFeature/Range...........................ok > t/SeqFeature/RangeI..........................ok > t/SeqFeature/SeqAnalysisParser...............ok > t/SeqFeature/SeqFeatAnnotated................1/34 > --------------------- WARNING --------------------- > MSG: [1/5] tried to fetch > http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo?rev=HEAD > , > but server threw 404. retrying... > --------------------------------------------------- > t/SeqFeature/SeqFeatAnnotated................ok > t/SeqFeature/SeqFeatCollection...............ok > t/SeqFeature/SeqFeature...................... All 214 subtests passed > t/SeqFeature/SeqFeaturePrimer................ok > t/SeqFeature/Unflattener.....................ok > t/SeqFeature/Unflattener2....................ok > > > > Dave > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From cjfields at illinois.edu Tue Jan 13 20:09:38 2009 From: cjfields at illinois.edu (Chris Fields) Date: Tue, 13 Jan 2009 19:09:38 -0600 Subject: [Bioperl-l] GDB Dead? Message-ID: <4687474B-E0D3-401A-A037-5781E6EA343E@illinois.edu> So I've been looking around for possible alternative servers for the Genome Database (GDB). www.gdb.org is dead, and I have been finding a few conflicting reports of the GDB being closed down this past July. Anyone know of its current status? It affects Bio::DB::GDB (which we'll probably have to deprecate). chris From hlapp at gmx.net Tue Jan 13 23:33:10 2009 From: hlapp at gmx.net (Hilmar Lapp) Date: Tue, 13 Jan 2009 23:33:10 -0500 Subject: [Bioperl-l] GDB Dead? In-Reply-To: <4687474B-E0D3-401A-A037-5781E6EA343E@illinois.edu> References: <4687474B-E0D3-401A-A037-5781E6EA343E@illinois.edu> Message-ID: <05BC147C-D30D-47D9-B310-5EA8A08BACE8@gmx.net> RTI (which had taken over hosting in 2003) closed it down last summer, yes. -hilmar On Jan 13, 2009, at 8:09 PM, Chris Fields wrote: > So I've been looking around for possible alternative servers for the > Genome Database (GDB). www.gdb.org is dead, and I have been finding > a few conflicting reports of the GDB being closed down this past July. > > Anyone know of its current status? It affects Bio::DB::GDB (which > we'll probably have to deprecate). > > chris > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l -- =========================================================== : Hilmar Lapp -:- Durham, NC -:- hlapp at gmx dot net : =========================================================== From hlapp at gmx.net Tue Jan 13 23:44:04 2009 From: hlapp at gmx.net (Hilmar Lapp) Date: Tue, 13 Jan 2009 23:44:04 -0500 Subject: [Bioperl-l] Bio::Seq::SeqWithQuality status In-Reply-To: <50C1E481-B3AF-449F-B085-5121B26D521E@illinois.edu> References: <2D0719BB-35B7-4D67-95E1-FD4AA5D83F3C@illinois.edu> <496CED68.5050600@gmail.com> <50C1E481-B3AF-449F-B085-5121B26D521E@illinois.edu> Message-ID: <64E9A3BE-3799-4303-86CB-F06497984A75@gmx.net> On Jan 13, 2009, at 7:31 PM, Chris Fields wrote: > We can remove it now but I think it's probably best to wait until > 1.7 since we're almost 3 RCs into a release. It should probably still be obvious from the documentation that we don't want users to consider using this module, right? -- =========================================================== : Hilmar Lapp -:- Durham, NC -:- hlapp at gmx dot net : =========================================================== From cjfields at illinois.edu Tue Jan 13 23:45:56 2009 From: cjfields at illinois.edu (Chris Fields) Date: Tue, 13 Jan 2009 22:45:56 -0600 Subject: [Bioperl-l] GDB Dead? In-Reply-To: <05BC147C-D30D-47D9-B310-5EA8A08BACE8@gmx.net> References: <4687474B-E0D3-401A-A037-5781E6EA343E@illinois.edu> <05BC147C-D30D-47D9-B310-5EA8A08BACE8@gmx.net> Message-ID: So I guess we can go ahead and immediately deprecate it. I'll go ahead and remove from trunk/branch-1-6 if no one disagrees, otherwise I'll add a deprecation message indicating the service is no longer available and remove in 1.7. chris On Jan 13, 2009, at 10:33 PM, Hilmar Lapp wrote: > RTI (which had taken over hosting in 2003) closed it down last > summer, yes. > > -hilmar > > On Jan 13, 2009, at 8:09 PM, Chris Fields wrote: > >> So I've been looking around for possible alternative servers for >> the Genome Database (GDB). www.gdb.org is dead, and I have been >> finding a few conflicting reports of the GDB being closed down this >> past July. >> >> Anyone know of its current status? It affects Bio::DB::GDB (which >> we'll probably have to deprecate). >> >> chris >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > > -- > =========================================================== > : Hilmar Lapp -:- Durham, NC -:- hlapp at gmx dot net : > =========================================================== > > > From cjfields at illinois.edu Tue Jan 13 23:50:13 2009 From: cjfields at illinois.edu (Chris Fields) Date: Tue, 13 Jan 2009 22:50:13 -0600 Subject: [Bioperl-l] Bio::Seq::SeqWithQuality status In-Reply-To: <64E9A3BE-3799-4303-86CB-F06497984A75@gmx.net> References: <2D0719BB-35B7-4D67-95E1-FD4AA5D83F3C@illinois.edu> <496CED68.5050600@gmail.com> <50C1E481-B3AF-449F-B085-5121B26D521E@illinois.edu> <64E9A3BE-3799-4303-86CB-F06497984A75@gmx.net> Message-ID: <60408B09-27A9-4901-A796-BFB98BE785CD@illinois.edu> On Jan 13, 2009, at 10:44 PM, Hilmar Lapp wrote: > > On Jan 13, 2009, at 7:31 PM, Chris Fields wrote: > >> We can remove it now but I think it's probably best to wait until >> 1.7 since we're almost 3 RCs into a release. > > It should probably still be obvious from the documentation that we > don't want users to consider using this module, right? Ah, but that requires users to RTM. Regardless, anyone attempting to use it will be alerted via Heikki's deprecation warning; I'll add to the DEPRECATED list and schedule it for removal in 1.7 (it was never added). chris From cjfields at illinois.edu Wed Jan 14 00:08:29 2009 From: cjfields at illinois.edu (Chris Fields) Date: Tue, 13 Jan 2009 23:08:29 -0600 Subject: [Bioperl-l] Deprecated methods Message-ID: <00D382C3-65CD-4748-9FC2-8040C275C42F@illinois.edu> Just ack'ed through the code and I have found many methods are noted as deprecated in bioperl, however they aren't clearly scheduled for removal in any future version. Should we revise Bio::Root::Root::deprecated to accept two arguments (text and bp version) to check against the Root::Version and convert a dep warning to a throw if the version matches up? Something like: # maybe check against both 1.x and 1.00x? $self->deprecated(-text => 'Use of foo() is deprecated. Use set_foo() instead', -version => 1.7); I don't think this'll break current code as _rearrange would just default the first argument to '-text' if the order is indicated. chris From nathan.watson-haigh at csiro.au Wed Jan 14 01:48:39 2009 From: nathan.watson-haigh at csiro.au (Nathan S. Watson-Haigh) Date: Wed, 14 Jan 2009 16:48:39 +1000 Subject: [Bioperl-l] About to tag the last RC... In-Reply-To: <628aabb70901131242o24868785m73462b7742fefa5f@mail.gmail.com> References: <306ED109-1E35-4769-A8AE-0FBB85EFAF7E@illinois.edu> <628aabb70901131049n45286df3j43078dea745065a5@mail.gmail.com> <628aabb70901131242o24868785m73462b7742fefa5f@mail.gmail.com> Message-ID: <496D8AC7.3030300@csiro.au> -----BEGIN PGP SIGNED MESSAGE----- Hash: SHA1 Been away from Perl for a while now, but still try to keep up-to-date with the mailing list. Anyway, since Chris mentioned that he'd not recieved much feedback on the latest RC's, I thought I'd checkout the trunk on a clean Ubuntu 8.04 Desktop. Opting not to install any optional deps or scripts and no network tests I get a non-zero exit status due to bad plan in t/SearchIO/blastxml (sorry for not putting the exact output as I'm running the tests on another machine): Parse errors: Bad plan. You planned 298 tests but ran 130. I had to resort to installing all dependencies to get this past this hurdle. However, after doing so, I now get a non-zero exit status for t/seqFeature/SeqFeature: Failed test: 86 Non-zero exit status: 1 Basically, I get an exception about acc AF032048 does not exist. In addition, the test at line 322 gives a different sequence to that being expected....the last 4 aa's appear to have be replaced by ~20 X's Anyway, thought I'd chirp in before the RC3 is tagged. Nath Dave Messina wrote: > Grabbed the trunk and tried again. > > This time, missing dependencies were correctly fetched and installed. > > I'm still getting the HIV error: > > t/RemoteDB/HIV/HIV...........................23/30 > # Failed test 'get HXB2 in a stream by accession' > # in t/RemoteDB/HIV/HIV.t at line 79. > # died: Bio::WebError::Exception ( > # ------------- EXCEPTION: Bio::WebError::Exception ------------- > # MSG: Unparsed failure at > /Users/dave/src/bioperl-live/blib/lib/Bio/DB/HIV.pm line 275. > # > # VALUE: An empty string ("") > # STACK: Error::throw > # STACK: Bio::Root::Root::throw > /Users/dave/src/bioperl-live/blib/lib/Bio/Root/Root.pm:357 > # STACK: Bio::DB::HIV::get_request > /Users/dave/src/bioperl-live/blib/lib/Bio/DB/HIV.pm:277 > # STACK: Bio::DB::HIV::get_seq_stream > /Users/dave/src/bioperl-live/blib/lib/Bio/DB/HIV.pm:396 > # STACK: Bio::DB::HIV::get_Stream_by_acc > /Users/dave/src/bioperl-live/blib/lib/Bio/DB/HIV.pm:491 > # STACK: Test::Exception::lives_ok t/RemoteDB/HIV/HIV.t:79 > # STACK: t/RemoteDB/HIV/HIV.t:79 > # --------------------------------------------------------------- > # ) > # Looks like you failed 1 test of 30. > t/RemoteDB/HIV/HIV........................... Dubious, test returned 1 > (wstat 256, 0x100) > Failed 1/30 subtests > (less 7 skipped subtests: 22 okay) > > > I also got a new warning, even though the test passed: > > t/Tree/TreeIO/svggraph.......................1/4 Use of uninitialized value > in join or string at /Library/Perl/5.8.8/SVG/Element.pm line 1195, > line 1. > t/Tree/TreeIO/svggraph.......................ok > > > > And then finally, check out the SeqFeature test parse errors in the summary: > > Test Summary Report > ------------------- > t/RemoteDB/DB (Wstat: 256 Tests: 116 Failed: 1) > Failed test: 104 > Non-zero exit status: 1 > t/RemoteDB/GDB (Wstat: 2048 Tests: 12 Failed: 8) > Failed tests: 4-7, 9-12 > Non-zero exit status: 8 > t/RemoteDB/HIV/HIV (Wstat: 256 Tests: 30 Failed: 1) > Failed test: 23 > Non-zero exit status: 1 > t/Root/RootIO (Wstat: 65280 Tests: 30 Failed: 0) > Non-zero exit status: 255 > Parse errors: Bad plan. You planned 31 tests but ran 30. > t/SeqFeature/SeqFeature (Wstat: 0 Tests: 350 Failed: 136) > Failed tests: 85-209, 209-210, 210-211, 211-212, 212-213 > 213-214, 214 > Parse errors: Tests out of sequence. Found (79) but expected (81) > Tests out of sequence. Found (80) but expected (82) > Tests out of sequence. Found (81) but expected (83) > Tests out of sequence. Found (82) but expected (84) > Tests out of sequence. Found (83) but expected (85) > Displayed the first 5 of 271 TAP syntax errors. > Re-run prove with the -p option to see them all. > Files=322, Tests=16672, 567 wallclock secs ( 3.70 usr 2.11 sys + 112.37 > cusr 17.65 csys = 135.83 CPU) > Result: FAIL > Failed 5/322 test programs. 146/16672 subtests failed. > 116.460u 20.044s 9:28.64 24.0% 0+0k 22+957io 2pf+0w > Exit 255 > > > All the SeqFeature tests passed; I wonder if the temporary 404 glitch was > responsible: > > t/SeqFeature/FeatureIO.......................ok > t/SeqFeature/Location........................ok > t/SeqFeature/LocationFactory.................ok > t/SeqFeature/Primer..........................ok > t/SeqFeature/Range...........................ok > t/SeqFeature/RangeI..........................ok > t/SeqFeature/SeqAnalysisParser...............ok > t/SeqFeature/SeqFeatAnnotated................1/34 > --------------------- WARNING --------------------- > MSG: [1/5] tried to fetch > http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo?rev=HEAD, > but server threw 404. retrying... > --------------------------------------------------- > t/SeqFeature/SeqFeatAnnotated................ok > t/SeqFeature/SeqFeatCollection...............ok > t/SeqFeature/SeqFeature...................... All 214 subtests passed > t/SeqFeature/SeqFeaturePrimer................ok > t/SeqFeature/Unflattener.....................ok > t/SeqFeature/Unflattener2....................ok > > > > Dave > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l - -- - -------------------------------------------------------- Dr. Nathan S. Watson-Haigh OCE Post Doctoral Fellow CSIRO Livestock Industries Queensland Bioscience Precinct St Lucia, QLD 4067 Australia Tel: +61 (0)7 3214 2922 Fax: +61 (0)7 3214 2900 Web: http://www.csiro.au/people/Nathan.Watson-Haigh.html - -------------------------------------------------------- -----BEGIN PGP SIGNATURE----- Version: GnuPG v1.4.9 (MingW32) Comment: Using GnuPG with Mozilla - http://enigmail.mozdev.org iEYEARECAAYFAkltiscACgkQ9gTv6QYzVL5ZfwCdFll/yw+E2xMzoQf2Tvql8COv 7iMAmwXkbowuOaS1FZiUXckccsofBKEa =EOqj -----END PGP SIGNATURE----- From David.Messina at sbc.su.se Wed Jan 14 03:29:09 2009 From: David.Messina at sbc.su.se (Dave Messina) Date: Wed, 14 Jan 2009 09:29:09 +0100 Subject: [Bioperl-l] Deprecated methods In-Reply-To: <00D382C3-65CD-4748-9FC2-8040C275C42F@illinois.edu> References: <00D382C3-65CD-4748-9FC2-8040C275C42F@illinois.edu> Message-ID: <628aabb70901140029g28df583ifbb0db210df5a667@mail.gmail.com> Great idea -- should make it a lot easier to have methods which are scheduled for removal in the future to announce themselves when the time comes. And for entire modules which are deprecated, presumably that call would be made at the end of the constuctor? Dave From David.Messina at sbc.su.se Wed Jan 14 04:53:00 2009 From: David.Messina at sbc.su.se (Dave Messina) Date: Wed, 14 Jan 2009 10:53:00 +0100 Subject: [Bioperl-l] About to tag the last RC... In-Reply-To: <496D8AC7.3030300@csiro.au> References: <306ED109-1E35-4769-A8AE-0FBB85EFAF7E@illinois.edu> <628aabb70901131049n45286df3j43078dea745065a5@mail.gmail.com> <628aabb70901131242o24868785m73462b7742fefa5f@mail.gmail.com> <496D8AC7.3030300@csiro.au> Message-ID: <628aabb70901140153o6d4075e4m434a43cbae1f917a@mail.gmail.com> Test report on trunk r15372, perl 5.8.8, CentOS 5.2, install all optional modules, install all scripts, do network tests. All passed -- just saw two minor warnings, one from Bio::DB::Registry and the same svggraph one as before. Dave t/LocalDB/Registry.............................1/14 --------------------- WARNING --------------------- MSG: Couldn't call new_from_registry() on [Bio::DB::Flat] ------------- EXCEPTION: Bio::Root::Exception ------------- MSG: you must specify an indexing scheme STACK: Error::throw STACK: Bio::Root::Root::throw Bio/Root/Root.pm:357 STACK: Bio::DB::Flat::new Bio/DB/Flat.pm:160 STACK: Bio::DB::Flat::new_from_registry Bio/DB/Flat.pm:252 STACK: Bio::DB::Registry::_load_registry Bio/DB/Registry.pm:164 STACK: Bio::DB::Registry::new Bio/DB/Registry.pm:95 STACK: t/LocalDB/Registry.t:51 ----------------------------------------------------------- --------------------------------------------------- t/LocalDB/Registry.............................ok t/Tree/TreeIO/svggraph.........................1/4 Use of uninitialized value in join or string at /afs/ pdc.kth.se/home/d/dmessina/lib/perl5/site_perl/5.8.8/SVG/Element.pm line 1195, line 1. t/Tree/TreeIO/svggraph.........................ok All tests successful. Files=322, Tests=20356, 545 wallclock secs ( 5.25 usr 0.87 sys + 173.39 cusr 26.97 csys = 206.48 CPU) Result: PASS From cjfields at illinois.edu Wed Jan 14 08:09:16 2009 From: cjfields at illinois.edu (Chris Fields) Date: Wed, 14 Jan 2009 07:09:16 -0600 Subject: [Bioperl-l] Deprecated methods In-Reply-To: <628aabb70901140029g28df583ifbb0db210df5a667@mail.gmail.com> References: <00D382C3-65CD-4748-9FC2-8040C275C42F@illinois.edu> <628aabb70901140029g28df583ifbb0db210df5a667@mail.gmail.com> Message-ID: On Jan 14, 2009, at 2:29 AM, Dave Messina wrote: > Great idea -- should make it a lot easier to have methods which are > scheduled for removal in the future to announce themselves when the > time comes. > > And for entire modules which are deprecated, presumably that call > would be made at the end of the constuctor? > > > Dave Yes that's the general idea. -c From cjfields at illinois.edu Wed Jan 14 08:24:19 2009 From: cjfields at illinois.edu (Chris Fields) Date: Wed, 14 Jan 2009 07:24:19 -0600 Subject: [Bioperl-l] About to tag the last RC... In-Reply-To: <496D8AC7.3030300@csiro.au> References: <306ED109-1E35-4769-A8AE-0FBB85EFAF7E@illinois.edu> <628aabb70901131049n45286df3j43078dea745065a5@mail.gmail.com> <628aabb70901131242o24868785m73462b7742fefa5f@mail.gmail.com> <496D8AC7.3030300@csiro.au> Message-ID: On Jan 14, 2009, at 12:48 AM, Nathan S. Watson-Haigh wrote: > -----BEGIN PGP SIGNED MESSAGE----- > Hash: SHA1 > > Been away from Perl for a while now, but still try to keep up-to- > date with the mailing list. > > Anyway, since Chris mentioned that he'd not recieved much feedback > on the latest RC's, I thought I'd > checkout the trunk on a clean Ubuntu 8.04 Desktop. > > Opting not to install any optional deps or scripts and no network > tests I get a non-zero exit status > due to bad plan in t/SearchIO/blastxml (sorry for not putting the > exact output as I'm running the > tests on another machine): > Parse errors: Bad plan. You planned 298 tests but ran 130. That's an odd one but it may be a test miscount. I'll double-check. I tried this on a clean Ubuntu 8.10 yesterday (perl 5.10) and had no problems beyond having to use 'sudo' to install the Data::Stag requirement. > I had to resort to installing all dependencies to get this past this > hurdle. However, after doing > so, I now get a non-zero exit status for t/seqFeature/SeqFeature: > Failed test: 86 > Non-zero exit status: 1 > > Basically, I get an exception about acc AF032048 does not exist. > In addition, the test at line 322 gives a different sequence to that > being expected....the last 4 > aa's appear to have be replaced by ~20 X's > > Anyway, thought I'd chirp in before the RC3 is tagged. > > Nath Okay, will look into that one (an odd one as well, but Dave reported something with the same batch of tests; different fails though. Thanks Nathan (and good to hear from you). chris > Dave Messina wrote: >> Grabbed the trunk and tried again. >> >> This time, missing dependencies were correctly fetched and installed. >> >> I'm still getting the HIV error: >> >> t/RemoteDB/HIV/HIV...........................23/30 >> # Failed test 'get HXB2 in a stream by accession' >> # in t/RemoteDB/HIV/HIV.t at line 79. >> # died: Bio::WebError::Exception ( >> # ------------- EXCEPTION: Bio::WebError::Exception ------------- >> # MSG: Unparsed failure at >> /Users/dave/src/bioperl-live/blib/lib/Bio/DB/HIV.pm line 275. >> # >> # VALUE: An empty string ("") >> # STACK: Error::throw >> # STACK: Bio::Root::Root::throw >> /Users/dave/src/bioperl-live/blib/lib/Bio/Root/Root.pm:357 >> # STACK: Bio::DB::HIV::get_request >> /Users/dave/src/bioperl-live/blib/lib/Bio/DB/HIV.pm:277 >> # STACK: Bio::DB::HIV::get_seq_stream >> /Users/dave/src/bioperl-live/blib/lib/Bio/DB/HIV.pm:396 >> # STACK: Bio::DB::HIV::get_Stream_by_acc >> /Users/dave/src/bioperl-live/blib/lib/Bio/DB/HIV.pm:491 >> # STACK: Test::Exception::lives_ok t/RemoteDB/HIV/HIV.t:79 >> # STACK: t/RemoteDB/HIV/HIV.t:79 >> # --------------------------------------------------------------- >> # ) >> # Looks like you failed 1 test of 30. >> t/RemoteDB/HIV/HIV........................... Dubious, test >> returned 1 >> (wstat 256, 0x100) >> Failed 1/30 subtests >> (less 7 skipped subtests: 22 okay) >> >> >> I also got a new warning, even though the test passed: >> >> t/Tree/TreeIO/svggraph.......................1/4 Use of >> uninitialized value >> in join or string at /Library/Perl/5.8.8/SVG/Element.pm line 1195, >> >> line 1. >> t/Tree/TreeIO/svggraph.......................ok >> >> >> >> And then finally, check out the SeqFeature test parse errors in the >> summary: >> >> Test Summary Report >> ------------------- >> t/RemoteDB/DB (Wstat: 256 Tests: 116 >> Failed: 1) >> Failed test: 104 >> Non-zero exit status: 1 >> t/RemoteDB/GDB (Wstat: 2048 Tests: 12 >> Failed: 8) >> Failed tests: 4-7, 9-12 >> Non-zero exit status: 8 >> t/RemoteDB/HIV/HIV (Wstat: 256 Tests: 30 >> Failed: 1) >> Failed test: 23 >> Non-zero exit status: 1 >> t/Root/RootIO (Wstat: 65280 Tests: 30 >> Failed: 0) >> Non-zero exit status: 255 >> Parse errors: Bad plan. You planned 31 tests but ran 30. >> t/SeqFeature/SeqFeature (Wstat: 0 Tests: 350 >> Failed: 136) >> Failed tests: 85-209, 209-210, 210-211, 211-212, 212-213 >> 213-214, 214 >> Parse errors: Tests out of sequence. Found (79) but expected (81) >> Tests out of sequence. Found (80) but expected (82) >> Tests out of sequence. Found (81) but expected (83) >> Tests out of sequence. Found (82) but expected (84) >> Tests out of sequence. Found (83) but expected (85) >> Displayed the first 5 of 271 TAP syntax errors. >> Re-run prove with the -p option to see them all. >> Files=322, Tests=16672, 567 wallclock secs ( 3.70 usr 2.11 sys + >> 112.37 >> cusr 17.65 csys = 135.83 CPU) >> Result: FAIL >> Failed 5/322 test programs. 146/16672 subtests failed. >> 116.460u 20.044s 9:28.64 24.0% 0+0k 22+957io 2pf+0w >> Exit 255 >> >> >> All the SeqFeature tests passed; I wonder if the temporary 404 >> glitch was >> responsible: >> >> t/SeqFeature/FeatureIO.......................ok >> t/SeqFeature/Location........................ok >> t/SeqFeature/LocationFactory.................ok >> t/SeqFeature/Primer..........................ok >> t/SeqFeature/Range...........................ok >> t/SeqFeature/RangeI..........................ok >> t/SeqFeature/SeqAnalysisParser...............ok >> t/SeqFeature/SeqFeatAnnotated................1/34 >> --------------------- WARNING --------------------- >> MSG: [1/5] tried to fetch >> http://song.cvs.sourceforge.net/*checkout*/song/ontology/so.obo?rev=HEAD >> , >> but server threw 404. retrying... >> --------------------------------------------------- >> t/SeqFeature/SeqFeatAnnotated................ok >> t/SeqFeature/SeqFeatCollection...............ok >> t/SeqFeature/SeqFeature...................... All 214 subtests passed >> t/SeqFeature/SeqFeaturePrimer................ok >> t/SeqFeature/Unflattener.....................ok >> t/SeqFeature/Unflattener2....................ok >> >> >> >> Dave >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > > > - -- > - -------------------------------------------------------- > Dr. Nathan S. Watson-Haigh > OCE Post Doctoral Fellow > CSIRO Livestock Industries > Queensland Bioscience Precinct > St Lucia, QLD 4067 > Australia > > Tel: +61 (0)7 3214 2922 > Fax: +61 (0)7 3214 2900 > Web: http://www.csiro.au/people/Nathan.Watson-Haigh.html > - -------------------------------------------------------- > > -----BEGIN PGP SIGNATURE----- > Version: GnuPG v1.4.9 (MingW32) > Comment: Using GnuPG with Mozilla - http://enigmail.mozdev.org > > iEYEARECAAYFAkltiscACgkQ9gTv6QYzVL5ZfwCdFll/yw+E2xMzoQf2Tvql8COv > 7iMAmwXkbowuOaS1FZiUXckccsofBKEa > =EOqj > -----END PGP SIGNATURE----- > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From cjfields at illinois.edu Wed Jan 14 08:28:06 2009 From: cjfields at illinois.edu (Chris Fields) Date: Wed, 14 Jan 2009 07:28:06 -0600 Subject: [Bioperl-l] About to tag the last RC... In-Reply-To: <628aabb70901140153o6d4075e4m434a43cbae1f917a@mail.gmail.com> References: <306ED109-1E35-4769-A8AE-0FBB85EFAF7E@illinois.edu> <628aabb70901131049n45286df3j43078dea745065a5@mail.gmail.com> <628aabb70901131242o24868785m73462b7742fefa5f@mail.gmail.com> <496D8AC7.3030300@csiro.au> <628aabb70901140153o6d4075e4m434a43cbae1f917a@mail.gmail.com> Message-ID: Yeah, the svggraph.t warning is something out of our control. I googled the error and found it's a general problem with SVG::Graph, so I'll let Allen know. I'll see if I can work out the other warning. The HIV.t warnings are sporadic and seem less frequent since last night. I noticed the HIV database migrated RDBMS yesterday so it may be related to that (Mark Jensen, the HIV modules author, is aware of the problem). Thanks Dave! -c On Jan 14, 2009, at 3:53 AM, Dave Messina wrote: > Test report on trunk r15372, perl 5.8.8, CentOS 5.2, install all > optional modules, install all scripts, do network tests. > > All passed -- just saw two minor warnings, one from > Bio::DB::Registry and the same svggraph one as before. > > Dave > > > > > t/LocalDB/Registry.............................1/14 > --------------------- WARNING --------------------- > MSG: Couldn't call new_from_registry() on [Bio::DB::Flat] > > ------------- EXCEPTION: Bio::Root::Exception ------------- > MSG: you must specify an indexing scheme > STACK: Error::throw > STACK: Bio::Root::Root::throw Bio/Root/Root.pm:357 > STACK: Bio::DB::Flat::new Bio/DB/Flat.pm:160 > STACK: Bio::DB::Flat::new_from_registry Bio/DB/Flat.pm:252 > STACK: Bio::DB::Registry::_load_registry Bio/DB/Registry.pm:164 > STACK: Bio::DB::Registry::new Bio/DB/Registry.pm:95 > STACK: t/LocalDB/Registry.t:51 > ----------------------------------------------------------- > > --------------------------------------------------- > t/LocalDB/Registry.............................ok > > > > t/Tree/TreeIO/svggraph.........................1/4 Use of > uninitialized value in join or string at /afs/pdc.kth.se/home/d/ > dmessina/lib/perl5/site_perl/5.8.8/SVG/Element.pm line 1195, > line 1. > t/Tree/TreeIO/svggraph.........................ok > > > > All tests successful. > Files=322, Tests=20356, 545 wallclock secs ( 5.25 usr 0.87 sys + > 173.39 cusr 26.97 csys = 206.48 CPU) > Result: PASS > > From davis at embl.de Wed Jan 14 09:46:47 2009 From: davis at embl.de (Chad Davis) Date: Wed, 14 Jan 2009 15:46:47 +0100 Subject: [Bioperl-l] About to tag the last RC... In-Reply-To: References: <306ED109-1E35-4769-A8AE-0FBB85EFAF7E@illinois.edu> <628aabb70901131049n45286df3j43078dea745065a5@mail.gmail.com> <628aabb70901131242o24868785m73462b7742fefa5f@mail.gmail.com> <496D8AC7.3030300@csiro.au> <628aabb70901140153o6d4075e4m434a43cbae1f917a@mail.gmail.com> Message-ID: Hi, I tested trunk r15372 (with network/DB tests) on: - Perl v5.10.0 built for i486-linux-gnu-thread-multi - Ubuntu 8.10 - Linux 2.6.27-11-generic #1 SMP Apart from some warnings, I had some problems with Bio::DB::MeSH Test Summary Report ------------------- t/RemoteDB/DB (Wstat: 768 Tests: 116 Failed: 3) Failed tests: 114-116 Non-zero exit status: 3 Files=323, Tests=19009, 544 wallclock secs ( 5.23 usr 1.21 sys + 209.70 cusr 11.88 csys = 228.02 CPU) Result: FAIL Failed 1/323 test programs. 3/19009 subtests failed. Specifically: t/RemoteDB/DB................................104/116 Use of uninitialized value $desc in substitution (s///) at /usr/local/home/davis/Desktop/bioperl-live-trunk/Bio/DB/MeSH.pm line 267. Use of uninitialized value $desc in substitution (s///) at /usr/local/home/davis/Desktop/bioperl-live-trunk/Bio/DB/MeSH.pm line 268. Use of uninitialized value $name in regexp compilation at /usr/local/home/davis/Desktop/bioperl-live-trunk/Bio/DB/MeSH.pm line 282. Use of uninitialized value $name in regexp compilation at /usr/local/home/davis/Desktop/bioperl-live-trunk/Bio/DB/MeSH.pm line 282. Use of uninitialized value $name in regexp compilation at /usr/local/home/davis/Desktop/bioperl-live-trunk/Bio/DB/MeSH.pm line 282. t/RemoteDB/DB................................114/116 # Failed test at t/RemoteDB/DB.t line 386. # got: '0' # expected: '2' Use of uninitialized value $desc in substitution (s///) at /usr/local/home/davis/Desktop/bioperl-live-trunk/Bio/DB/MeSH.pm line 267. Use of uninitialized value $desc in substitution (s///) at /usr/local/home/davis/Desktop/bioperl-live-trunk/Bio/DB/MeSH.pm line 268. Use of uninitialized value $name in regexp compilation at /usr/local/home/davis/Desktop/bioperl-live-trunk/Bio/DB/MeSH.pm line 282. Use of uninitialized value $name in regexp compilation at /usr/local/home/davis/Desktop/bioperl-live-trunk/Bio/DB/MeSH.pm line 282. Use of uninitialized value $name in regexp compilation at /usr/local/home/davis/Desktop/bioperl-live-trunk/Bio/DB/MeSH.pm line 282. Use of uninitialized value $name in regexp compilation at /usr/local/home/davis/Desktop/bioperl-live-trunk/Bio/DB/MeSH.pm line 282. Use of uninitialized value $name in regexp compilation at /usr/local/home/davis/Desktop/bioperl-live-trunk/Bio/DB/MeSH.pm line 282. t/RemoteDB/DB................................115/116 # Failed test at t/RemoteDB/DB.t line 389. # got: undef # expected: 'Thrombus formation in an intracranial venous sinus, including the superior sagittal, cavernous, lateral, and petrous sinuses. Etiologies include thrombosis due to infection, DEHYDRATION, coagulation disorders (see THROMBOPHILIA), and CRANIOCEREBRAL TRAUMA.' # Failed test at t/RemoteDB/DB.t line 390. # got: undef # expected: 'D012851' # Looks like you failed 3 tests of 116. t/RemoteDB/DB................................ Dubious, test returned 3 (wstat 768, 0x300) Failed 3/116 subtests (less 17 skipped subtests: 96 okay) Cheers, Chad On Wed, Jan 14, 2009 at 14:28, Chris Fields wrote: > Yeah, the svggraph.t warning is something out of our control. I googled > the error and found it's a general problem with SVG::Graph, so I'll let > Allen know. I'll see if I can work out the other warning. > > The HIV.t warnings are sporadic and seem less frequent since last night. I > noticed the HIV database migrated RDBMS yesterday so it may be related to > that (Mark Jensen, the HIV modules author, is aware of the problem). > > Thanks Dave! > > -c > > > On Jan 14, 2009, at 3:53 AM, Dave Messina wrote: > > Test report on trunk r15372, perl 5.8.8, CentOS 5.2, install all optional >> modules, install all scripts, do network tests. >> >> All passed -- just saw two minor warnings, one from Bio::DB::Registry and >> the same svggraph one as before. >> >> Dave >> >> >> >> >> t/LocalDB/Registry.............................1/14 >> --------------------- WARNING --------------------- >> MSG: Couldn't call new_from_registry() on [Bio::DB::Flat] >> >> ------------- EXCEPTION: Bio::Root::Exception ------------- >> MSG: you must specify an indexing scheme >> STACK: Error::throw >> STACK: Bio::Root::Root::throw Bio/Root/Root.pm:357 >> STACK: Bio::DB::Flat::new Bio/DB/Flat.pm:160 >> STACK: Bio::DB::Flat::new_from_registry Bio/DB/Flat.pm:252 >> STACK: Bio::DB::Registry::_load_registry Bio/DB/Registry.pm:164 >> STACK: Bio::DB::Registry::new Bio/DB/Registry.pm:95 >> STACK: t/LocalDB/Registry.t:51 >> ----------------------------------------------------------- >> >> --------------------------------------------------- >> t/LocalDB/Registry.............................ok >> >> >> >> t/Tree/TreeIO/svggraph.........................1/4 Use of uninitialized >> value in join or string at /afs/pdc.kth.se/home/d/dmessina/lib/perl5/site_perl/5.8.8/SVG/Element.pm >> line 1195, line 1. >> t/Tree/TreeIO/svggraph.........................ok >> >> >> >> All tests successful. >> Files=322, Tests=20356, 545 wallclock secs ( 5.25 usr 0.87 sys + 173.39 >> cusr 26.97 csys = 206.48 CPU) >> Result: PASS >> >> >> > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > From SMarkel at accelrys.com Wed Jan 14 18:45:10 2009 From: SMarkel at accelrys.com (Scott Markel) Date: Wed, 14 Jan 2009 18:45:10 -0500 Subject: [Bioperl-l] About to tag the last RC... In-Reply-To: <306ED109-1E35-4769-A8AE-0FBB85EFAF7E@illinois.edu> References: <306ED109-1E35-4769-A8AE-0FBB85EFAF7E@illinois.edu> Message-ID: <1F1240778FB0AF46B4E5A72C44D2C7471725E542@exch1-hi.accelrys.net> Chris, We've been testing 1.6 RC2 with our set of nightly Pipeline Pilot regressions and have noticed a few issues. Sorry we couldn't get this feedback to you sooner. 1) There is a problem with the output filename for bl2seq on Windows. In response to bug 2707, quotemeta was used when building the parameter string at line 507 in Bio::Tools::Run::StandAloneNCBIBlast (1.5.9_2). This causes a problem with the path to the output file on Windows. For example, "C:\DOCUME~1\outfile" becomes "C\:\\DOCUME\~1\\outfile". bl2seq can't open the output file and fails. 2) Parsing megablast output (format 2) with Bio::SearchIO::blast.pm now returns an algorithm name of "BLASTN" instead of "MEGABLAST". This change seems to have been introduced in revision 11579 of blast.pm when a couple regex changes were made (lines 452 and 1201 of blast.pm in 1.5.9_2). Subbing in the old regular expression for megablast in line 452 returned the correct "MEGABLAST" algorithm name. We also see some minor differences that we can live with, e.g., BLAST hit scores changing from 40 to 40.1 and e-values having trailing zeros. We'll just update our baselines. The change to using Bio::Annotation::TagTree for SwissProt sequence gene names broke a number of our tests but we'll fix that by modifying the adapters we use between our internal representation and BioPerl's. One thing we haven't tracked down yet is a change in tag type, e.g., b:integervalue to b:stringvalue, in the XML representations of our Pipeline Pilot data records. We're only seeing this for programs in NCBI's BLAST suite. At this point we don't know what's changed on the BioPerl side to trigger the change in our code. We'll continue to investigate this. Scott Scott Markel, Ph.D. Principal Bioinformatics Architect email: smarkel at accelrys.com Accelrys (SciTegic R&D) mobile: +1 858 205 3653 10188 Telesis Court, Suite 100 voice: +1 858 799 5603 San Diego, CA 92121 fax: +1 858 799 5222 USA web: http://www.accelrys.com http://www.linkedin.com/in/smarkel Board of Directors: International Society for Computational Biology Co-chair: ISCB Publications Committee Associate Editor: PLoS Computational Biology Editorial Board: Briefings in Bioinformatics > -----Original Message----- > From: bioperl-l-bounces at lists.open-bio.org [mailto:bioperl-l- > bounces at lists.open-bio.org] On Behalf Of Chris Fields > Sent: Tuesday, 13 January 2009 9:28 AM > To: BioPerl List > Subject: [Bioperl-l] About to tag the last RC... > > All, > > I'm going to run one more RC round for bioperl before the final 1.6 > release; there are some odd test failures on CPAN Testers I'm trying > to rectify. I will probably tag/bag/release RC3 sometime this > afternoon. > > Any complaints? Issues? Bugs? Haven't heard any feedback except > from Sendu (which is a worry for a stable release). > > chris > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From cjfields at illinois.edu Thu Jan 15 00:17:31 2009 From: cjfields at illinois.edu (Chris Fields) Date: Wed, 14 Jan 2009 23:17:31 -0600 Subject: [Bioperl-l] About to tag the last RC... In-Reply-To: <1F1240778FB0AF46B4E5A72C44D2C7471725E542@exch1-hi.accelrys.net> References: <306ED109-1E35-4769-A8AE-0FBB85EFAF7E@illinois.edu> <1F1240778FB0AF46B4E5A72C44D2C7471725E542@exch1-hi.accelrys.net> Message-ID: On Jan 14, 2009, at 5:45 PM, Scott Markel wrote: > Chris, > > We've been testing 1.6 RC2 with our set of nightly Pipeline Pilot > regressions and have noticed a few issues. Sorry we couldn't get > this feedback to you sooner. > > 1) There is a problem with the output filename for bl2seq on > Windows. In response to bug 2707, quotemeta was used when building > the parameter string at line 507 in > Bio::Tools::Run::StandAloneNCBIBlast (1.5.9_2). This causes a > problem with the path to the output file on Windows. For example, > "C:\DOCUME~1\outfile" becomes "C\:\\DOCUME\~1\\outfile". bl2seq > can't open the output file and fails. I've added an OS check for that so this isn't used with Windows (I wondered whether quotemeta would bite me there). I'm seriously considering ripping out that code altogether, though. I'm not sure we want to wade into attempting to accurately escape shell chars simply based on OS differences. > 2) Parsing megablast output (format 2) with Bio::SearchIO::blast.pm > now returns an algorithm name of "BLASTN" instead of "MEGABLAST". > This change seems to have been introduced in revision 11579 of > blast.pm when a couple regex changes were made (lines 452 and 1201 > of blast.pm in 1.5.9_2). Subbing in the old regular expression for > megablast in line 452 returned the correct "MEGABLAST" algorithm name. I worked out why that regex isn't working (it doesn't match MEGABLAST at all). I fixed it and added a test for checking the algorithm to the test suite for MEGABLAST output, seems to work now. > We also see some minor differences that we can live with, e.g., > BLAST hit scores changing from 40 to 40.1 and e-values having > trailing zeros. We'll just update our baselines. Okay, but let me know if that becomes pressing. The e-value issue is a bit odd and may be worth looking into. > The change to using Bio::Annotation::TagTree for SwissProt sequence > gene names broke a number of our tests but we'll fix that by > modifying the adapters we use between our internal representation > and BioPerl's. That would be from the switchover from StructureValue (which wasn't really designed for the purposes of storing such data). A layered Bio::Annotation::Collection was the other option (this is almost a light version of that). > One thing we haven't tracked down yet is a change in tag type, e.g., > b:integervalue to b:stringvalue, in the XML representations of our > Pipeline Pilot data records. We're only seeing this for programs in > NCBI's BLAST suite. At this point we don't know what's changed on > the BioPerl side to trigger the change in our code. We'll continue > to investigate this. Again, if you find it's on our side let us know. > Scott > > Scott Markel, Ph.D. > Principal Bioinformatics Architect email: smarkel at accelrys.com > Accelrys (SciTegic R&D) mobile: +1 858 205 3653 > 10188 Telesis Court, Suite 100 voice: +1 858 799 5603 > San Diego, CA 92121 fax: +1 858 799 5222 > USA web: http://www.accelrys.com > > http://www.linkedin.com/in/smarkel > Board of Directors: International Society for Computational Biology > Co-chair: ISCB Publications Committee > Associate Editor: PLoS Computational Biology > Editorial Board: Briefings in Bioinformatics Thanks Scott! Let us know if you have any other problems. I've been busier than expected but should get RC3 out soon. -c From SMarkel at accelrys.com Thu Jan 15 09:14:50 2009 From: SMarkel at accelrys.com (Scott Markel) Date: Thu, 15 Jan 2009 09:14:50 -0500 Subject: [Bioperl-l] About to tag the last RC... In-Reply-To: References: <306ED109-1E35-4769-A8AE-0FBB85EFAF7E@illinois.edu> <1F1240778FB0AF46B4E5A72C44D2C7471725E542@exch1-hi.accelrys.net> Message-ID: <1F1240778FB0AF46B4E5A72C44D2C74717371E2E@exch1-hi.accelrys.net> Chris, Thank you for the quick reply, the changes, and for all of your work to get 1.6 ready. Scott > -----Original Message----- > From: Chris Fields [mailto:cjfields at illinois.edu] > Sent: Wednesday, 14 January 2009 9:18 PM > To: Scott Markel > Cc: BioPerl List; Kristine Briedis > Subject: Re: [Bioperl-l] About to tag the last RC... > > On Jan 14, 2009, at 5:45 PM, Scott Markel wrote: > > > Chris, > > > > We've been testing 1.6 RC2 with our set of nightly Pipeline Pilot > > regressions and have noticed a few issues. Sorry we couldn't get > > this feedback to you sooner. > > > > 1) There is a problem with the output filename for bl2seq on > > Windows. In response to bug 2707, quotemeta was used when building > > the parameter string at line 507 in > > Bio::Tools::Run::StandAloneNCBIBlast (1.5.9_2). This causes a > > problem with the path to the output file on Windows. For example, > > "C:\DOCUME~1\outfile" becomes "C\:\\DOCUME\~1\\outfile". bl2seq > > can't open the output file and fails. > > I've added an OS check for that so this isn't used with Windows (I > wondered whether quotemeta would bite me there). I'm seriously > considering ripping out that code altogether, though. I'm not sure we > want to wade into attempting to accurately escape shell chars simply > based on OS differences. > > > 2) Parsing megablast output (format 2) with Bio::SearchIO::blast.pm > > now returns an algorithm name of "BLASTN" instead of "MEGABLAST". > > This change seems to have been introduced in revision 11579 of > > blast.pm when a couple regex changes were made (lines 452 and 1201 > > of blast.pm in 1.5.9_2). Subbing in the old regular expression for > > megablast in line 452 returned the correct "MEGABLAST" algorithm name. > > I worked out why that regex isn't working (it doesn't match MEGABLAST > at all). I fixed it and added a test for checking the algorithm to > the test suite for MEGABLAST output, seems to work now. > > > We also see some minor differences that we can live with, e.g., > > BLAST hit scores changing from 40 to 40.1 and e-values having > > trailing zeros. We'll just update our baselines. > > Okay, but let me know if that becomes pressing. The e-value issue is > a bit odd and may be worth looking into. > > > The change to using Bio::Annotation::TagTree for SwissProt sequence > > gene names broke a number of our tests but we'll fix that by > > modifying the adapters we use between our internal representation > > and BioPerl's. > > That would be from the switchover from StructureValue (which wasn't > really designed for the purposes of storing such data). A layered > Bio::Annotation::Collection was the other option (this is almost a > light version of that). > > > One thing we haven't tracked down yet is a change in tag type, e.g., > > b:integervalue to b:stringvalue, in the XML representations of our > > Pipeline Pilot data records. We're only seeing this for programs in > > NCBI's BLAST suite. At this point we don't know what's changed on > > the BioPerl side to trigger the change in our code. We'll continue > > to investigate this. > > Again, if you find it's on our side let us know. > > > Scott > > > > Scott Markel, Ph.D. > > Principal Bioinformatics Architect email: smarkel at accelrys.com > > Accelrys (SciTegic R&D) mobile: +1 858 205 3653 > > 10188 Telesis Court, Suite 100 voice: +1 858 799 5603 > > San Diego, CA 92121 fax: +1 858 799 5222 > > USA web: http://www.accelrys.com > > > > http://www.linkedin.com/in/smarkel > > Board of Directors: International Society for Computational Biology > > Co-chair: ISCB Publications Committee > > Associate Editor: PLoS Computational Biology > > Editorial Board: Briefings in Bioinformatics > > Thanks Scott! Let us know if you have any other problems. I've been > busier than expected but should get RC3 out soon. > > -c From cjfields at illinois.edu Thu Jan 15 19:09:35 2009 From: cjfields at illinois.edu (Chris Fields) Date: Thu, 15 Jan 2009 18:09:35 -0600 Subject: [Bioperl-l] GDB Dead? In-Reply-To: References: <4687474B-E0D3-401A-A037-5781E6EA343E@illinois.edu> <05BC147C-D30D-47D9-B310-5EA8A08BACE8@gmx.net> Message-ID: Okay, no objections, so I'll go ahead and remove it (and related tests) from main trunk. chris On Jan 13, 2009, at 10:45 PM, Chris Fields wrote: > So I guess we can go ahead and immediately deprecate it. I'll go > ahead and remove from trunk/branch-1-6 if no one disagrees, > otherwise I'll add a deprecation message indicating the service is > no longer available and remove in 1.7. > > chris > > On Jan 13, 2009, at 10:33 PM, Hilmar Lapp wrote: > >> RTI (which had taken over hosting in 2003) closed it down last >> summer, yes. >> >> -hilmar >> >> On Jan 13, 2009, at 8:09 PM, Chris Fields wrote: >> >>> So I've been looking around for possible alternative servers for >>> the Genome Database (GDB). www.gdb.org is dead, and I have been >>> finding a few conflicting reports of the GDB being closed down >>> this past July. >>> >>> Anyone know of its current status? It affects Bio::DB::GDB (which >>> we'll probably have to deprecate). >>> >>> chris >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> >> -- >> =========================================================== >> : Hilmar Lapp -:- Durham, NC -:- hlapp at gmx dot net : >> =========================================================== >> >> >> > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From cjfields at illinois.edu Fri Jan 16 14:11:13 2009 From: cjfields at illinois.edu (Chris Fields) Date: Fri, 16 Jan 2009 13:11:13 -0600 Subject: [Bioperl-l] [ANNOUCEMENT] BioPerl 1.6 RC3 Message-ID: <176C5E7F-4E8C-442A-82A1-8B56B70F7F3F@illinois.edu> All, I would like to announce that the third (and hopefully final) release candidate for BioPerl 1.6 is now available for testing. As this is likely the final release candidate, any errors encountered during regression tests would be greatly appreciated. A quick note on versioning: due to issues with alpha numbered versions on CPAN possibly overwriting or taking precedence over a stable release, this release candidate has a VERSION of 1.005009_003 (or 1.005009003). This will be switched to 1.006000 (no alpha) once the release is final. The RC is currently being uploaded to CPAN and should be available in the next 24-48 hours under authorname CJFIELDS. In the meantime, the release candidates can be directly downloaded here: http://bioperl.org/DIST/BioPerl-1.5.9_3.tar.bz2 http://bioperl.org/DIST/BioPerl-1.5.9_3.tar.gz http://bioperl.org/DIST/BioPerl-1.5.9_3.zip Signature file: http://bioperl.org/DIST/SIGNATURES.md5 A preliminary ActiveState PPM is also available and is located in the BioPerl Release Candidate repository; the directions for installation are here: http://www.bioperl.org/wiki/Installing_Bioperl_on_Windows Please feel free to report issues with testing, installation, etc. on the mail list and on this page: http://www.bioperl.org/wiki/Release_1.6_Testing Again, just to note we will be releasing bioperl-run, bioperl-db, bioperl-network, and others separately once the final 1.6 release is complete. Since the last release: Fixes: 1) Remote database tests are now a bit more robust. 2) Bio::DB::GDB and related tests have been deprecated and removed (GDB is no longer available). 3) More warnings and test failures (via CPAN Testers) now fixed. 4) BLAST-related file and parsing issues resolved (per Scott Markel). 5) Small test fixes. Known Issues: 1) Warnings for Bio::Assembly tests are for incomplete phrap parsing. These modules will be a focus of BioPerl 1.7; in the meantime I'll see about quenching the tests. 2) Warnings for Bio::Annotation tests can be fixed by an upgrade to the latest Data::Stag (this is NOT a required upgrade). 3) PPM issues; note this is not high on our priority list ATM but I will try to address it for the next release. 4) Small warning for t/Tree/TreeIO/svggraph.t due to an issue with SVG::Graph. Enjoy! chris _______________________________________________ Bioperl-l mailing list Bioperl-l at lists.open-bio.org http://lists.open-bio.org/mailman/listinfo/bioperl-l From cjfields at illinois.edu Sat Jan 17 16:53:00 2009 From: cjfields at illinois.edu (Chris Fields) Date: Sat, 17 Jan 2009 15:53:00 -0600 Subject: [Bioperl-l] evalues/floating point tests Message-ID: <79B1C536-4723-45B0-8AE6-209BDE84F5CF@illinois.edu> I've noticed an odd issue when testing BioPerl on WinXP yesterday which doesn't appear to be popping up anywhere else. When comparing floating point numbers, several tests fail like the following: # Failed test at t\SearchIO\blast_pull.t line 40. # got: '1e-23' # expected: '1e-023' # Failed test at t\SearchIO\blast_pull.t line 67. # got: '6e-59' # expected: '6e-059' These are generally in lines like (for the example above) is $result->get_parameter('expect'), 1e-23; I'm adding a method to Bio::Root::Test for comparing two floating point numbers based on equality: float_eq $float1, $float2, $message; This basically wraps is() but runs both values through 'sprintf("%g", $foo)' prior to the comparison; it has a prototype requiring two values to be passed and an optional message. Any objections to the method name or adding this in? I've already converted many of the tests in t/SearchIO over but wanted to pass it by the group prior to an actual commit. chris From cjfields at illinois.edu Sat Jan 17 17:22:31 2009 From: cjfields at illinois.edu (Chris Fields) Date: Sat, 17 Jan 2009 16:22:31 -0600 Subject: [Bioperl-l] evalues/floating point tests In-Reply-To: References: <79B1C536-4723-45B0-8AE6-209BDE84F5CF@illinois.edu> Message-ID: Mark, If you have any additional errors post them here if you have time (particularly for Strawberry Perl): http://www.bioperl.org/wiki/Release_1.6_Testing or you can send them in to me. Related to Win installation I may try downloading ActivePerl for Mac OS X and test out PPM connectivity if I have time this weekend. I'm pretty sure the evalue issue has popped up before. In fact, Scott Markel reported additional zeros appearing in evals, along with file name problems with Windows. chris On Jan 17, 2009, at 4:06 PM, Mark A. Jensen wrote: > I am getting these funky fails as well (ActiveState/Cygwin/Vista and > strawberry/Cygwin/Vista); I'm all for the kludge, should prevent a > LOT of chatter at support, but I can try to ferret out the > underlying issue. > > ----- Original Message ----- From: "Chris Fields" > > To: "BioPerl List" > Sent: Saturday, January 17, 2009 4:53 PM > Subject: [Bioperl-l] evalues/floating point tests > > >> I've noticed an odd issue when testing BioPerl on WinXP yesterday >> which doesn't appear to be popping up anywhere else. When >> comparing floating point numbers, several tests fail like the >> following: >> >> # Failed test at t\SearchIO\blast_pull.t line 40. >> # got: '1e-23' >> # expected: '1e-023' >> >> # Failed test at t\SearchIO\blast_pull.t line 67. >> # got: '6e-59' >> # expected: '6e-059' >> >> These are generally in lines like (for the example above) >> >> is $result->get_parameter('expect'), 1e-23; >> >> I'm adding a method to Bio::Root::Test for comparing two floating >> point numbers based on equality: >> >> float_eq $float1, $float2, $message; >> >> This basically wraps is() but runs both values through >> 'sprintf("%g", $foo)' prior to the comparison; it has a prototype >> requiring two values to be passed and an optional message. Any >> objections to the method name or adding this in? I've already >> converted many of the tests in t/SearchIO over but wanted to pass >> it by the group prior to an actual commit. >> >> chris >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > From maj at fortinbras.us Sat Jan 17 17:06:23 2009 From: maj at fortinbras.us (Mark A. Jensen) Date: Sat, 17 Jan 2009 17:06:23 -0500 Subject: [Bioperl-l] evalues/floating point tests In-Reply-To: <79B1C536-4723-45B0-8AE6-209BDE84F5CF@illinois.edu> References: <79B1C536-4723-45B0-8AE6-209BDE84F5CF@illinois.edu> Message-ID: I am getting these funky fails as well (ActiveState/Cygwin/Vista and strawberry/Cygwin/Vista); I'm all for the kludge, should prevent a LOT of chatter at support, but I can try to ferret out the underlying issue. ----- Original Message ----- From: "Chris Fields" To: "BioPerl List" Sent: Saturday, January 17, 2009 4:53 PM Subject: [Bioperl-l] evalues/floating point tests > I've noticed an odd issue when testing BioPerl on WinXP yesterday which > doesn't appear to be popping up anywhere else. When comparing floating point > numbers, several tests fail like the following: > > # Failed test at t\SearchIO\blast_pull.t line 40. > # got: '1e-23' > # expected: '1e-023' > > # Failed test at t\SearchIO\blast_pull.t line 67. > # got: '6e-59' > # expected: '6e-059' > > These are generally in lines like (for the example above) > > is $result->get_parameter('expect'), 1e-23; > > I'm adding a method to Bio::Root::Test for comparing two floating point > numbers based on equality: > > float_eq $float1, $float2, $message; > > This basically wraps is() but runs both values through 'sprintf("%g", $foo)' > prior to the comparison; it has a prototype requiring two values to be passed > and an optional message. Any objections to the method name or adding this > in? I've already converted many of the tests in t/SearchIO over but wanted > to pass it by the group prior to an actual commit. > > chris > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > From maj at fortinbras.us Sat Jan 17 18:08:13 2009 From: maj at fortinbras.us (Mark A. Jensen) Date: Sat, 17 Jan 2009 18:08:13 -0500 Subject: [Bioperl-l] evalues/floating point tests In-Reply-To: References: <79B1C536-4723-45B0-8AE6-209BDE84F5CF@illinois.edu> Message-ID: <992A477DA343422EA571D479CC7467C6@NewLife> OK- I'll do a fresh build of RC3 and send the results- (I recall seeing the issue in the HSP tests some while back as well...) ----- Original Message ----- From: "Chris Fields" To: "Mark A. Jensen" Cc: "BioPerl List" Sent: Saturday, January 17, 2009 5:22 PM Subject: Re: [Bioperl-l] evalues/floating point tests > Mark, > > If you have any additional errors post them here if you have time > (particularly for Strawberry Perl): > > http://www.bioperl.org/wiki/Release_1.6_Testing > > or you can send them in to me. Related to Win installation I may try > downloading ActivePerl for Mac OS X and test out PPM connectivity if I > have time this weekend. > > I'm pretty sure the evalue issue has popped up before. In fact, Scott > Markel reported additional zeros appearing in evals, along with file > name problems with Windows. > > chris > > On Jan 17, 2009, at 4:06 PM, Mark A. Jensen wrote: > >> I am getting these funky fails as well (ActiveState/Cygwin/Vista and >> strawberry/Cygwin/Vista); I'm all for the kludge, should prevent a >> LOT of chatter at support, but I can try to ferret out the >> underlying issue. >> >> ----- Original Message ----- From: "Chris Fields" > > >> To: "BioPerl List" >> Sent: Saturday, January 17, 2009 4:53 PM >> Subject: [Bioperl-l] evalues/floating point tests >> >> >>> I've noticed an odd issue when testing BioPerl on WinXP yesterday >>> which doesn't appear to be popping up anywhere else. When >>> comparing floating point numbers, several tests fail like the >>> following: >>> >>> # Failed test at t\SearchIO\blast_pull.t line 40. >>> # got: '1e-23' >>> # expected: '1e-023' >>> >>> # Failed test at t\SearchIO\blast_pull.t line 67. >>> # got: '6e-59' >>> # expected: '6e-059' >>> >>> These are generally in lines like (for the example above) >>> >>> is $result->get_parameter('expect'), 1e-23; >>> >>> I'm adding a method to Bio::Root::Test for comparing two floating >>> point numbers based on equality: >>> >>> float_eq $float1, $float2, $message; >>> >>> This basically wraps is() but runs both values through >>> 'sprintf("%g", $foo)' prior to the comparison; it has a prototype >>> requiring two values to be passed and an optional message. Any >>> objections to the method name or adding this in? I've already >>> converted many of the tests in t/SearchIO over but wanted to pass >>> it by the group prior to an actual commit. >>> >>> chris >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>> >> > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > From cjfields at illinois.edu Sat Jan 17 18:22:05 2009 From: cjfields at illinois.edu (Chris Fields) Date: Sat, 17 Jan 2009 17:22:05 -0600 Subject: [Bioperl-l] evalues/floating point tests In-Reply-To: <992A477DA343422EA571D479CC7467C6@NewLife> References: <79B1C536-4723-45B0-8AE6-209BDE84F5CF@illinois.edu> <992A477DA343422EA571D479CC7467C6@NewLife> Message-ID: <4406A3F9-C4C1-41D8-9C7E-26141C244437@illinois.edu> Oh, my guess is you'll see the same errors. I didn't have a Windows system to test on until yesterday so no changes were made until a couple hours after RC3 was packaged up. Unfortunately every test I've seen has been from anything else but Windows. A checkout and test of main trunk would help more, particularly after the evalue and float_eq() commit (which may come down the pipe tonight). I can weed out the tests for modules not in the branch. chris On Jan 17, 2009, at 5:08 PM, Mark A. Jensen wrote: > OK- I'll do a fresh build of RC3 and send the results- (I recall > seeing the issue in the HSP tests some while back as well...) > > ----- Original Message ----- From: "Chris Fields" > > To: "Mark A. Jensen" > Cc: "BioPerl List" > Sent: Saturday, January 17, 2009 5:22 PM > Subject: Re: [Bioperl-l] evalues/floating point tests > > >> Mark, >> If you have any additional errors post them here if you have time >> (particularly for Strawberry Perl): >> http://www.bioperl.org/wiki/Release_1.6_Testing >> or you can send them in to me. Related to Win installation I may >> try downloading ActivePerl for Mac OS X and test out PPM >> connectivity if I have time this weekend. >> I'm pretty sure the evalue issue has popped up before. In fact, >> Scott Markel reported additional zeros appearing in evals, along >> with file name problems with Windows. >> chris >> On Jan 17, 2009, at 4:06 PM, Mark A. Jensen wrote: >>> I am getting these funky fails as well (ActiveState/Cygwin/Vista >>> and strawberry/Cygwin/Vista); I'm all for the kludge, should >>> prevent a LOT of chatter at support, but I can try to ferret out >>> the underlying issue. >>> >>> ----- Original Message ----- From: "Chris Fields" >> > >>> To: "BioPerl List" >>> Sent: Saturday, January 17, 2009 4:53 PM >>> Subject: [Bioperl-l] evalues/floating point tests >>> >>> >>>> I've noticed an odd issue when testing BioPerl on WinXP >>>> yesterday which doesn't appear to be popping up anywhere else. >>>> When comparing floating point numbers, several tests fail like >>>> the following: >>>> >>>> # Failed test at t\SearchIO\blast_pull.t line 40. >>>> # got: '1e-23' >>>> # expected: '1e-023' >>>> >>>> # Failed test at t\SearchIO\blast_pull.t line 67. >>>> # got: '6e-59' >>>> # expected: '6e-059' >>>> >>>> These are generally in lines like (for the example above) >>>> >>>> is $result->get_parameter('expect'), 1e-23; >>>> >>>> I'm adding a method to Bio::Root::Test for comparing two >>>> floating point numbers based on equality: >>>> >>>> float_eq $float1, $float2, $message; >>>> >>>> This basically wraps is() but runs both values through >>>> 'sprintf("%g", $foo)' prior to the comparison; it has a >>>> prototype requiring two values to be passed and an optional >>>> message. Any objections to the method name or adding this in? >>>> I've already converted many of the tests in t/SearchIO over but >>>> wanted to pass it by the group prior to an actual commit. >>>> >>>> chris >>>> _______________________________________________ >>>> Bioperl-l mailing list >>>> Bioperl-l at lists.open-bio.org >>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>> >>> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From bix at sendu.me.uk Sat Jan 17 18:45:21 2009 From: bix at sendu.me.uk (Sendu Bala) Date: Sat, 17 Jan 2009 23:45:21 +0000 Subject: [Bioperl-l] evalues/floating point tests In-Reply-To: <79B1C536-4723-45B0-8AE6-209BDE84F5CF@illinois.edu> References: <79B1C536-4723-45B0-8AE6-209BDE84F5CF@illinois.edu> Message-ID: <49726D91.8050003@sendu.me.uk> Chris Fields wrote: > I've noticed an odd issue when testing BioPerl on WinXP yesterday which > doesn't appear to be popping up anywhere else. When comparing floating > point numbers, several tests fail like the following: > > # Failed test at t\SearchIO\blast_pull.t line 40. > # got: '1e-23' > # expected: '1e-023' > > # Failed test at t\SearchIO\blast_pull.t line 67. > # got: '6e-59' > # expected: '6e-059' > > These are generally in lines like (for the example above) > > is $result->get_parameter('expect'), 1e-23; > > I'm adding a method to Bio::Root::Test for comparing two floating point > numbers based on equality: > > float_eq $float1, $float2, $message; > > This basically wraps is() but runs both values through 'sprintf("%g", > $foo)' prior to the comparison; it has a prototype requiring two values > to be passed and an optional message. Any objections to the method name > or adding this in? is_float() seems more consistent? Other than that, great idea. From maj at fortinbras.us Sat Jan 17 18:32:26 2009 From: maj at fortinbras.us (Mark A. Jensen) Date: Sat, 17 Jan 2009 18:32:26 -0500 Subject: [Bioperl-l] evalues/floating point tests In-Reply-To: <4406A3F9-C4C1-41D8-9C7E-26141C244437@illinois.edu> References: <79B1C536-4723-45B0-8AE6-209BDE84F5CF@illinois.edu><992A477DA343422EA571D479CC7467C6@NewLife> <4406A3F9-C4C1-41D8-9C7E-26141C244437@illinois.edu> Message-ID: <2ACFDBA7EFD147A9BD69E163A0235D3C@NewLife> sounds good- MAJ ----- Original Message ----- From: "Chris Fields" To: "Mark A. Jensen" Cc: "BioPerl List" Sent: Saturday, January 17, 2009 6:22 PM Subject: Re: [Bioperl-l] evalues/floating point tests > Oh, my guess is you'll see the same errors. I didn't have a Windows > system to test on until yesterday so no changes were made until a > couple hours after RC3 was packaged up. Unfortunately every test I've > seen has been from anything else but Windows. > > A checkout and test of main trunk would help more, particularly after > the evalue and float_eq() commit (which may come down the pipe > tonight). I can weed out the tests for modules not in the branch. > > chris > > On Jan 17, 2009, at 5:08 PM, Mark A. Jensen wrote: > >> OK- I'll do a fresh build of RC3 and send the results- (I recall >> seeing the issue in the HSP tests some while back as well...) >> >> ----- Original Message ----- From: "Chris Fields" > > >> To: "Mark A. Jensen" >> Cc: "BioPerl List" >> Sent: Saturday, January 17, 2009 5:22 PM >> Subject: Re: [Bioperl-l] evalues/floating point tests >> >> >>> Mark, >>> If you have any additional errors post them here if you have time >>> (particularly for Strawberry Perl): >>> http://www.bioperl.org/wiki/Release_1.6_Testing >>> or you can send them in to me. Related to Win installation I may >>> try downloading ActivePerl for Mac OS X and test out PPM >>> connectivity if I have time this weekend. >>> I'm pretty sure the evalue issue has popped up before. In fact, >>> Scott Markel reported additional zeros appearing in evals, along >>> with file name problems with Windows. >>> chris >>> On Jan 17, 2009, at 4:06 PM, Mark A. Jensen wrote: >>>> I am getting these funky fails as well (ActiveState/Cygwin/Vista >>>> and strawberry/Cygwin/Vista); I'm all for the kludge, should >>>> prevent a LOT of chatter at support, but I can try to ferret out >>>> the underlying issue. >>>> >>>> ----- Original Message ----- From: "Chris Fields" >>> > >>>> To: "BioPerl List" >>>> Sent: Saturday, January 17, 2009 4:53 PM >>>> Subject: [Bioperl-l] evalues/floating point tests >>>> >>>> >>>>> I've noticed an odd issue when testing BioPerl on WinXP >>>>> yesterday which doesn't appear to be popping up anywhere else. >>>>> When comparing floating point numbers, several tests fail like >>>>> the following: >>>>> >>>>> # Failed test at t\SearchIO\blast_pull.t line 40. >>>>> # got: '1e-23' >>>>> # expected: '1e-023' >>>>> >>>>> # Failed test at t\SearchIO\blast_pull.t line 67. >>>>> # got: '6e-59' >>>>> # expected: '6e-059' >>>>> >>>>> These are generally in lines like (for the example above) >>>>> >>>>> is $result->get_parameter('expect'), 1e-23; >>>>> >>>>> I'm adding a method to Bio::Root::Test for comparing two >>>>> floating point numbers based on equality: >>>>> >>>>> float_eq $float1, $float2, $message; >>>>> >>>>> This basically wraps is() but runs both values through >>>>> 'sprintf("%g", $foo)' prior to the comparison; it has a >>>>> prototype requiring two values to be passed and an optional >>>>> message. Any objections to the method name or adding this in? >>>>> I've already converted many of the tests in t/SearchIO over but >>>>> wanted to pass it by the group prior to an actual commit. >>>>> >>>>> chris >>>>> _______________________________________________ >>>>> Bioperl-l mailing list >>>>> Bioperl-l at lists.open-bio.org >>>>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>>>> >>>> >>> _______________________________________________ >>> Bioperl-l mailing list >>> Bioperl-l at lists.open-bio.org >>> http://lists.open-bio.org/mailman/listinfo/bioperl-l >>> >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > From cjfields at illinois.edu Sat Jan 17 21:24:41 2009 From: cjfields at illinois.edu (Chris Fields) Date: Sat, 17 Jan 2009 20:24:41 -0600 Subject: [Bioperl-l] evalues/floating point tests In-Reply-To: <49726D91.8050003@sendu.me.uk> References: <79B1C536-4723-45B0-8AE6-209BDE84F5CF@illinois.edu> <49726D91.8050003@sendu.me.uk> Message-ID: <7A9332DC-3BFD-4CBD-AE86-0E67ED024976@illinois.edu> On Jan 17, 2009, at 5:45 PM, Sendu Bala wrote: > Chris Fields wrote: >> I've noticed an odd issue when testing BioPerl on WinXP yesterday >> which doesn't appear to be popping up anywhere else. When >> comparing floating point numbers, several tests fail like the >> following: >> # Failed test at t\SearchIO\blast_pull.t line 40. >> # got: '1e-23' >> # expected: '1e-023' >> # Failed test at t\SearchIO\blast_pull.t line 67. >> # got: '6e-59' >> # expected: '6e-059' >> These are generally in lines like (for the example above) >> is $result->get_parameter('expect'), 1e-23; >> I'm adding a method to Bio::Root::Test for comparing two floating >> point numbers based on equality: >> float_eq $float1, $float2, $message; >> This basically wraps is() but runs both values through >> 'sprintf("%g", $foo)' prior to the comparison; it has a prototype >> requiring two values to be passed and an optional message. Any >> objections to the method name or adding this in? > > is_float() seems more consistent? Other than that, great idea. I thought the same thing at first, but (at least to me) is_float sounds more like a boolean test on whether the scalar value passed is a float rather than a comparison checking whether two floats are equal. I'll go ahead and commit this, but it would be very easy to switch the method name over. chris From maj at fortinbras.us Sat Jan 17 21:44:59 2009 From: maj at fortinbras.us (Mark A. Jensen) Date: Sat, 17 Jan 2009 21:44:59 -0500 Subject: [Bioperl-l] evalues/floating point tests In-Reply-To: <7A9332DC-3BFD-4CBD-AE86-0E67ED024976@illinois.edu> References: <79B1C536-4723-45B0-8AE6-209BDE84F5CF@illinois.edu><49726D91.8050003@sendu.me.uk> <7A9332DC-3BFD-4CBD-AE86-0E67ED024976@illinois.edu> Message-ID: <1C24073D1D9A47129D96783531D718F9@NewLife> how bout is_asfloat() ? ----- Original Message ----- From: "Chris Fields" To: "Sendu Bala" Cc: "BioPerl List" Sent: Saturday, January 17, 2009 9:24 PM Subject: Re: [Bioperl-l] evalues/floating point tests > On Jan 17, 2009, at 5:45 PM, Sendu Bala wrote: > >> Chris Fields wrote: >>> I've noticed an odd issue when testing BioPerl on WinXP yesterday >>> which doesn't appear to be popping up anywhere else. When >>> comparing floating point numbers, several tests fail like the >>> following: >>> # Failed test at t\SearchIO\blast_pull.t line 40. >>> # got: '1e-23' >>> # expected: '1e-023' >>> # Failed test at t\SearchIO\blast_pull.t line 67. >>> # got: '6e-59' >>> # expected: '6e-059' >>> These are generally in lines like (for the example above) >>> is $result->get_parameter('expect'), 1e-23; >>> I'm adding a method to Bio::Root::Test for comparing two floating >>> point numbers based on equality: >>> float_eq $float1, $float2, $message; >>> This basically wraps is() but runs both values through >>> 'sprintf("%g", $foo)' prior to the comparison; it has a prototype >>> requiring two values to be passed and an optional message. Any >>> objections to the method name or adding this in? >> >> is_float() seems more consistent? Other than that, great idea. > > I thought the same thing at first, but (at least to me) is_float > sounds more like a boolean test on whether the scalar value passed is > a float rather than a comparison checking whether two floats are equal. > > I'll go ahead and commit this, but it would be very easy to switch the > method name over. > > chris > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > From bosborne11 at verizon.net Sat Jan 17 22:05:23 2009 From: bosborne11 at verizon.net (Brian Osborne) Date: Sat, 17 Jan 2009 22:05:23 -0500 Subject: [Bioperl-l] [ANNOUCEMENT] BioPerl 1.6 RC3 In-Reply-To: <176C5E7F-4E8C-442A-82A1-8B56B70F7F3F@illinois.edu> References: <176C5E7F-4E8C-442A-82A1-8B56B70F7F3F@illinois.edu> Message-ID: <06477E94-3F95-48E0-9EA6-F6B1307325CC@verizon.net> Chris, Looks good. I do see a bunch of errors concerning the modules that use the Staden library. It looks like I have some older Staden library on my laptop, "wrong architecture". Not sure how you want to deal with that but I'd say that this is not the fault of Bioperl. The second issue is this: t/Tree/TreeIO/phyloxml.........................You tried to plan twice! Second plan at t/Tree/TreeIO/phyloxml.t line 17 BEGIN failed--compilation aborted at t/Tree/TreeIO/phyloxml.t line 22. # Looks like your test died before it could output anything. t/Tree/TreeIO/phyloxml......................... Dubious, test returned 255 (wstat 65280, 0xff00) Failed 97/97 subtests Perl: This is perl, v5.8.8 built for darwin-thread-multi-2level (with 1 registered patch, see perl -V for more detail) Test Summary Report ------------------- t/SeqIO/abi.t (Wstat: 65280 Tests: 1 Failed: 0) Non-zero exit status: 255 Parse errors: Bad plan. You planned 7 tests but ran 1. t/SeqIO/alf.t (Wstat: 65280 Tests: 1 Failed: 0) Non-zero exit status: 255 Parse errors: Bad plan. You planned 8 tests but ran 1. t/SeqIO/ctf.t (Wstat: 65280 Tests: 1 Failed: 0) Non-zero exit status: 255 Parse errors: Bad plan. You planned 4 tests but ran 1. t/SeqIO/exp.t (Wstat: 65280 Tests: 1 Failed: 0) Non-zero exit status: 255 Parse errors: Bad plan. You planned 3 tests but ran 1. t/SeqIO/pln.t (Wstat: 65280 Tests: 1 Failed: 0) Non-zero exit status: 255 Parse errors: Bad plan. You planned 4 tests but ran 1. t/SeqIO/ztr.t (Wstat: 65280 Tests: 1 Failed: 0) Non-zero exit status: 255 Parse errors: Bad plan. You planned 3 tests but ran 1. t/Tree/TreeIO/phyloxml.t (Wstat: 65280 Tests: 0 Failed: 0) Non-zero exit status: 255 Parse errors: Bad plan. You planned 97 tests but ran 0. Files=318, Tests=17997, 133 wallclock secs ( 2.88 usr 1.74 sys + 109.70 cusr 15.28 csys = 129.60 CPU) Result: FAIL Failed 7/318 test programs. 0/17997 subtests failed. Brian O. t/SeqIO/abi....................................1/7 Had problems bootstrapping Inline module 'Bio::SeqIO::staden::read' Can't load '/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/ SeqIO/staden/read/read.bundle' for module Bio::SeqIO::staden::read: dlopen(/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/ staden/read/read.bundle, 1): no suitable image found. Did find: /Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/staden/ read/read.bundle: mach-o, but wrong architecture at /System/Library/ Perl/5.8.8/darwin-thread-multi-2level/DynaLoader.pm line 230, line 1. at /Library/Perl/5.8.6/Inline.pm line 500 at /System/Library/Perl/5.8.8/darwin-thread-multi-2level/ DynaLoader.pm line 0 INIT failed--call queue aborted, line 1. # Looks like you planned 7 tests but only ran 1. # Looks like your test died just after 1. t/SeqIO/abi.................................... Dubious, test returned 255 (wstat 65280, 0xff00) Failed 6/7 subtests t/SeqIO/ace....................................ok t/SeqIO/agave..................................ok t/SeqIO/alf....................................1/8 Had problems bootstrapping Inline module 'Bio::SeqIO::staden::read' Can't load '/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/ SeqIO/staden/read/read.bundle' for module Bio::SeqIO::staden::read: dlopen(/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/ staden/read/read.bundle, 1): no suitable image found. Did find: /Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/staden/ read/read.bundle: mach-o, but wrong architecture at /System/Library/ Perl/5.8.8/darwin-thread-multi-2level/DynaLoader.pm line 230, line 1. at /Library/Perl/5.8.6/Inline.pm line 500 at /System/Library/Perl/5.8.8/darwin-thread-multi-2level/ DynaLoader.pm line 0 INIT failed--call queue aborted, line 1. # Looks like you planned 8 tests but only ran 1. # Looks like your test died just after 1. t/SeqIO/alf.................................... Dubious, test returned 255 (wstat 65280, 0xff00) Failed 7/8 subtests t/SeqIO/asciitree..............................ok t/SeqIO/bsml...................................ok t/SeqIO/bsml_sax...............................skipped: The optional module XML::SAX::Writer (or dependencies thereof) was not installed t/SeqIO/chadoxml...............................ok t/SeqIO/chaos..................................ok t/SeqIO/chaosxml...............................ok t/SeqIO/ctf....................................1/4 Had problems bootstrapping Inline module 'Bio::SeqIO::staden::read' Can't load '/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/ SeqIO/staden/read/read.bundle' for module Bio::SeqIO::staden::read: dlopen(/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/ staden/read/read.bundle, 1): no suitable image found. Did find: /Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/staden/ read/read.bundle: mach-o, but wrong architecture at /System/Library/ Perl/5.8.8/darwin-thread-multi-2level/DynaLoader.pm line 230, line 1. at /Library/Perl/5.8.6/Inline.pm line 500 at /System/Library/Perl/5.8.8/darwin-thread-multi-2level/ DynaLoader.pm line 0 INIT failed--call queue aborted, line 1. # Looks like you planned 4 tests but only ran 1. # Looks like your test died just after 1. t/SeqIO/ctf.................................... Dubious, test returned 255 (wstat 65280, 0xff00) Failed 3/4 subtests t/SeqIO/embl...................................ok t/SeqIO/entrezgene.............................skipped: The optional module Bio::ASN1::EntrezGene (or dependencies thereof) was not installed t/SeqIO/excel..................................ok t/SeqIO/exp....................................1/3 Had problems bootstrapping Inline module 'Bio::SeqIO::staden::read' Can't load '/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/ SeqIO/staden/read/read.bundle' for module Bio::SeqIO::staden::read: dlopen(/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/ staden/read/read.bundle, 1): no suitable image found. Did find: /Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/staden/ read/read.bundle: mach-o, but wrong architecture at /System/Library/ Perl/5.8.8/darwin-thread-multi-2level/DynaLoader.pm line 230, line 1. at /Library/Perl/5.8.6/Inline.pm line 500 at /System/Library/Perl/5.8.8/darwin-thread-multi-2level/ DynaLoader.pm line 0 INIT failed--call queue aborted, line 1. # Looks like you planned 3 tests but only ran 1. # Looks like your test died just after 1. t/SeqIO/exp.................................... Dubious, test returned 255 (wstat 65280, 0xff00) Failed 2/3 subtests t/SeqIO/fasta..................................ok t/SeqIO/fastq..................................ok t/SeqIO/flybase_chadoxml.......................ok t/SeqIO/game...................................ok t/SeqIO/gcg....................................1/17 # Failed (TODO) test 'primary_id' # in t/SeqIO/gcg.t at line 54. # got: 'Bio::PrimarySeq=HASH(0x97fe30)' # expected: 'roa1_drome' t/SeqIO/gcg....................................ok t/SeqIO/genbank................................ok t/SeqIO/interpro...............................ok t/SeqIO/kegg...................................ok t/SeqIO/largefasta.............................ok t/SeqIO/lasergene..............................ok t/SeqIO/locuslink..............................ok t/SeqIO/metafasta..............................ok t/SeqIO/phd....................................ok t/SeqIO/pir....................................ok t/SeqIO/pln....................................1/4 Had problems bootstrapping Inline module 'Bio::SeqIO::staden::read' Can't load '/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/ SeqIO/staden/read/read.bundle' for module Bio::SeqIO::staden::read: dlopen(/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/ staden/read/read.bundle, 1): no suitable image found. Did find: /Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/staden/ read/read.bundle: mach-o, but wrong architecture at /System/Library/ Perl/5.8.8/darwin-thread-multi-2level/DynaLoader.pm line 230, line 1. at /Library/Perl/5.8.6/Inline.pm line 500 at /System/Library/Perl/5.8.8/darwin-thread-multi-2level/ DynaLoader.pm line 0 INIT failed--call queue aborted, line 1. # Looks like you planned 4 tests but only ran 1. # Looks like your test died just after 1. t/SeqIO/pln.................................... Dubious, test returned 255 (wstat 65280, 0xff00) Failed 3/4 subtests t/SeqIO/qual...................................ok t/SeqIO/raw....................................ok t/SeqIO/scf....................................1/59 # Failed (TODO) test 'accuracies' # in t/SeqIO/scf.t at line 78. # got: 'ARRAY(0x995314)' # expected: '482' t/SeqIO/scf....................................ok t/SeqIO/strider................................skipped: The optional module Convert::Binary::C (or dependencies thereof) was not installed t/SeqIO/swiss..................................ok t/SeqIO/tab....................................ok t/SeqIO/table..................................ok t/SeqIO/tigr...................................ok t/SeqIO/tigrxml................................skipped: The optional module XML::SAX::Writer (or dependencies thereof) was not installed t/SeqIO/tinyseq................................ok t/SeqIO/ztr....................................1/3 Had problems bootstrapping Inline module 'Bio::SeqIO::staden::read' Can't load '/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/ SeqIO/staden/read/read.bundle' for module Bio::SeqIO::staden::read: dlopen(/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/ staden/read/read.bundle, 1): no suitable image found. Did find: /Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/staden/ read/read.bundle: mach-o, but wrong architecture at /System/Library/ Perl/5.8.8/darwin-thread-multi-2level/DynaLoader.pm line 230, line 1. at /Library/Perl/5.8.6/Inline.pm line 500 at /System/Library/Perl/5.8.8/darwin-thread-multi-2level/ DynaLoader.pm line 0 INIT failed--call queue aborted, line 1. # Looks like you planned 3 tests but only ran 1. # Looks like your test died just after 1. t/SeqIO/ztr.................................... Dubious, test returned 255 (wstat 65280, 0xff00) Failed 2/3 subtests t/SeqTools/CodonTable..........................ok t/SeqTools/ECnumber............................ok t/SeqTools/GuessSeqFormat......................ok t/SeqTools/OddCodes............................ok t/SeqTools/SeqPattern..........................ok t/SeqTools/SeqStats............................ok t/SeqTools/SeqUtils............................ok t/SeqTools/SeqWords............................ok t/Species......................................ok t/Structure/IO.................................ok t/Structure/Structure..........................ok t/Symbol.......................................ok t/TaxonTree....................................skipped: All tests are being skipped, probably because the module(s) being tested here are now deprecated t/Tools/Alignment/Consed.......................ok t/Tools/Analysis/DNA/ESEfinder.................skipped: Network tests have not been requested t/Tools/Analysis/Protein/Domcut................skipped: Network tests have not been requested t/Tools/Analysis/Protein/ELM...................skipped: Network tests have not been requested t/Tools/Analysis/Protein/GOR4..................skipped: Network tests have not been requested t/Tools/Analysis/Protein/HNN...................skipped: Network tests have not been requested t/Tools/Analysis/Protein/Mitoprot..............skipped: Network tests have not been requested t/Tools/Analysis/Protein/NetPhos...............skipped: Network tests have not been requested t/Tools/Analysis/Protein/Scansite..............ok t/Tools/Analysis/Protein/Sopma.................ok t/Tools/EMBOSS/Palindrome......................ok t/Tools/EUtilities/EUtilParameters.............ok t/Tools/EUtilities/egquery.....................ok t/Tools/EUtilities/einfo.......................ok t/Tools/EUtilities/elink_acheck................ok t/Tools/EUtilities/elink_lcheck................ok t/Tools/EUtilities/elink_llinks................ok t/Tools/EUtilities/elink_ncheck................ok t/Tools/EUtilities/elink_neighbor..............ok t/Tools/EUtilities/elink_neighbor_history......ok t/Tools/EUtilities/elink_scores................ok t/Tools/EUtilities/epost.......................ok t/Tools/EUtilities/esearch.....................ok t/Tools/EUtilities/espell......................ok t/Tools/EUtilities/esummary....................ok t/Tools/Est2Genome.............................ok t/Tools/FootPrinter............................ok t/Tools/GFF....................................ok t/Tools/Geneid.................................ok t/Tools/Genewise...............................ok t/Tools/Genomewise.............................ok t/Tools/Genpred................................ok t/Tools/Hmmer..................................ok t/Tools/IUPAC..................................ok t/Tools/Lucy...................................ok t/Tools/Match..................................ok t/Tools/Phylo/Gerp.............................ok t/Tools/Phylo/Molphy...........................ok t/Tools/Phylo/PAML.............................ok t/Tools/Phylo/Phylip/ProtDist..................ok t/Tools/Primer3................................ok t/Tools/Promoterwise...........................ok t/Tools/Pseudowise.............................ok t/Tools/QRNA...................................ok t/Tools/RandDistFunctions......................ok t/Tools/RepeatMasker...........................ok t/Tools/Run/RemoteBlast........................skipped: Network tests have not been requested t/Tools/Run/StandAloneBlast....................ok t/Tools/Run/WrapperBase........................ok t/Tools/Seg....................................ok t/Tools/SiRNA..................................ok t/Tools/Sigcleave..............................ok t/Tools/Signalp................................ok t/Tools/Signalp/ExtendedSignalp................ok t/Tools/Sim4...................................ok t/Tools/Spidey/Spidey..........................ok t/Tools/TandemRepeatsFinder....................ok t/Tools/TargetP................................ok t/Tools/Tmhmm..................................ok t/Tools/ePCR...................................ok t/Tools/pICalculator...........................ok t/Tools/rnamotif...............................skipped: All tests are being skipped, probably because the module(s) being tested here are now deprecated t/Tools/tRNAscanSE.............................ok t/Tree/Compatible..............................ok t/Tree/Node....................................ok t/Tree/PhyloNetwork/Factory....................ok t/Tree/PhyloNetwork/GraphViz...................ok t/Tree/PhyloNetwork/MuVector...................ok t/Tree/PhyloNetwork/PhyloNetwork...............ok t/Tree/PhyloNetwork/RandomFactory..............skipped: The optional module Math::Random (or dependencies thereof) was not installed t/Tree/PhyloNetwork/TreeFactory................ok t/Tree/RandomTreeFactory.......................ok t/Tree/Tree....................................ok t/Tree/TreeIO..................................ok t/Tree/TreeIO/lintree..........................ok t/Tree/TreeIO/newick...........................ok t/Tree/TreeIO/nexus............................ok t/Tree/TreeIO/nhx..............................ok t/Tree/TreeIO/phyloxml.........................You tried to plan twice! Second plan at t/Tree/TreeIO/phyloxml.t line 17 BEGIN failed--compilation aborted at t/Tree/TreeIO/phyloxml.t line 22. # Looks like your test died before it could output anything. t/Tree/TreeIO/phyloxml......................... Dubious, test returned 255 (wstat 65280, 0xff00) Failed 97/97 subtests t/Tree/TreeIO/svggraph.........................1/4 Use of uninitialized value in join or string at /Library/Perl/5.8.6/SVG/ Element.pm line 1169, line 1. t/Tree/TreeIO/svggraph.........................ok t/Tree/TreeIO/tabtree..........................ok t/Tree/TreeStatistics..........................ok t/Variation/AAChange...........................ok t/Variation/AAReverseMutate....................ok t/Variation/Allele.............................ok t/Variation/DNAMutation........................ok t/Variation/RNAChange..........................ok t/Variation/SNP................................ok t/Variation/SeqDiff............................ok t/Variation/Variation_IO.......................ok On Jan 16, 2009, at 2:11 PM, Chris Fields wrote: > All, > > I would like to announce that the third (and hopefully final) > release candidate for BioPerl 1.6 is now available for testing. As > this is likely the final release candidate, any errors encountered > during regression tests would be greatly appreciated. > > A quick note on versioning: due to issues with alpha numbered > versions on CPAN possibly overwriting or taking precedence over a > stable release, this release candidate has a VERSION of 1.005009_003 > (or 1.005009003). This will be switched to 1.006000 (no alpha) once > the release is final. > > The RC is currently being uploaded to CPAN and should be available > in the next 24-48 hours under authorname CJFIELDS. In the meantime, > the release candidates can be directly downloaded here: > > http://bioperl.org/DIST/BioPerl-1.5.9_3.tar.bz2 > http://bioperl.org/DIST/BioPerl-1.5.9_3.tar.gz > http://bioperl.org/DIST/BioPerl-1.5.9_3.zip > > Signature file: > http://bioperl.org/DIST/SIGNATURES.md5 > > A preliminary ActiveState PPM is also available and is located in > the BioPerl Release Candidate repository; the directions for > installation are here: > > http://www.bioperl.org/wiki/Installing_Bioperl_on_Windows > > Please feel free to report issues with testing, installation, etc. > on the mail list and on this page: > > http://www.bioperl.org/wiki/Release_1.6_Testing > > Again, just to note we will be releasing bioperl-run, bioperl-db, > bioperl-network, and others separately once the final 1.6 release is > complete. > > Since the last release: > > Fixes: > > 1) Remote database tests are now a bit more robust. > 2) Bio::DB::GDB and related tests have been deprecated and removed > (GDB is no longer available). > 3) More warnings and test failures (via CPAN Testers) now fixed. > 4) BLAST-related file and parsing issues resolved (per Scott Markel). > 5) Small test fixes. > > Known Issues: > > 1) Warnings for Bio::Assembly tests are for incomplete phrap > parsing. These modules will be a focus of BioPerl 1.7; in the > meantime I'll see about quenching the tests. > 2) Warnings for Bio::Annotation tests can be fixed by an upgrade to > the latest Data::Stag (this is NOT a required upgrade). > 3) PPM issues; note this is not high on our priority list ATM but I > will try to address it for the next release. > 4) Small warning for t/Tree/TreeIO/svggraph.t due to an issue with > SVG::Graph. > > Enjoy! > > chris > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From cjfields at illinois.edu Sun Jan 18 00:07:09 2009 From: cjfields at illinois.edu (Chris Fields) Date: Sat, 17 Jan 2009 23:07:09 -0600 Subject: [Bioperl-l] [ANNOUCEMENT] BioPerl 1.6 RC3 In-Reply-To: <06477E94-3F95-48E0-9EA6-F6B1307325CC@verizon.net> References: <176C5E7F-4E8C-442A-82A1-8B56B70F7F3F@illinois.edu> <06477E94-3F95-48E0-9EA6-F6B1307325CC@verizon.net> Message-ID: Brian, Okay, I see what's wrong with the phyloxml tests, have fixed it (some leftover cruft). Thanks for pointing that one out! I had some problems with the latest version of io_lib myself but only with abi.t. ABI and ALF formats do not come with io_lib anymore (I think they are still included in the staden lib download, though). For some reason we have a test suite for Bio::SeqIO::alf but apparently no test data! chris On Jan 17, 2009, at 9:05 PM, Brian Osborne wrote: > Chris, > > Looks good. I do see a bunch of errors concerning the modules that > use the Staden library. It looks like I have some older Staden > library on my laptop, "wrong architecture". Not sure how you want to > deal with that but I'd say that this is not the fault of Bioperl. > > The second issue is this: > > t/Tree/TreeIO/phyloxml.........................You tried to plan > twice! Second plan at t/Tree/TreeIO/phyloxml.t line 17 > BEGIN failed--compilation aborted at t/Tree/TreeIO/phyloxml.t line 22. > # Looks like your test died before it could output anything. > t/Tree/TreeIO/phyloxml......................... Dubious, test > returned 255 (wstat 65280, 0xff00) > Failed 97/97 subtests > > Perl: > > This is perl, v5.8.8 built for darwin-thread-multi-2level > (with 1 registered patch, see perl -V for more detail) > > > > Test Summary Report > ------------------- > t/SeqIO/abi.t (Wstat: 65280 Tests: 1 > Failed: 0) > Non-zero exit status: 255 > Parse errors: Bad plan. You planned 7 tests but ran 1. > t/SeqIO/alf.t (Wstat: 65280 Tests: 1 > Failed: 0) > Non-zero exit status: 255 > Parse errors: Bad plan. You planned 8 tests but ran 1. > t/SeqIO/ctf.t (Wstat: 65280 Tests: 1 > Failed: 0) > Non-zero exit status: 255 > Parse errors: Bad plan. You planned 4 tests but ran 1. > t/SeqIO/exp.t (Wstat: 65280 Tests: 1 > Failed: 0) > Non-zero exit status: 255 > Parse errors: Bad plan. You planned 3 tests but ran 1. > t/SeqIO/pln.t (Wstat: 65280 Tests: 1 > Failed: 0) > Non-zero exit status: 255 > Parse errors: Bad plan. You planned 4 tests but ran 1. > t/SeqIO/ztr.t (Wstat: 65280 Tests: 1 > Failed: 0) > Non-zero exit status: 255 > Parse errors: Bad plan. You planned 3 tests but ran 1. > t/Tree/TreeIO/phyloxml.t (Wstat: 65280 Tests: 0 > Failed: 0) > Non-zero exit status: 255 > Parse errors: Bad plan. You planned 97 tests but ran 0. > Files=318, Tests=17997, 133 wallclock secs ( 2.88 usr 1.74 sys + > 109.70 cusr 15.28 csys = 129.60 CPU) > Result: FAIL > Failed 7/318 test programs. 0/17997 subtests failed. > > > Brian O. > > > t/SeqIO/abi....................................1/7 Had problems > bootstrapping Inline module 'Bio::SeqIO::staden::read' > > Can't load '/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/ > SeqIO/staden/read/read.bundle' for module Bio::SeqIO::staden::read: > dlopen(/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/ > staden/read/read.bundle, 1): no suitable image found. Did find: > /Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/ > staden/read/read.bundle: mach-o, but wrong architecture at /System/ > Library/Perl/5.8.8/darwin-thread-multi-2level/DynaLoader.pm line > 230, line 1. > at /Library/Perl/5.8.6/Inline.pm line 500 > > > at /System/Library/Perl/5.8.8/darwin-thread-multi-2level/ > DynaLoader.pm line 0 > INIT failed--call queue aborted, line 1. > # Looks like you planned 7 tests but only ran 1. > # Looks like your test died just after 1. > t/SeqIO/abi.................................... Dubious, test > returned 255 (wstat 65280, 0xff00) > Failed 6/7 subtests > t/SeqIO/ace....................................ok > t/SeqIO/agave..................................ok > t/SeqIO/alf....................................1/8 Had problems > bootstrapping Inline module 'Bio::SeqIO::staden::read' > > Can't load '/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/ > SeqIO/staden/read/read.bundle' for module Bio::SeqIO::staden::read: > dlopen(/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/ > staden/read/read.bundle, 1): no suitable image found. Did find: > /Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/ > staden/read/read.bundle: mach-o, but wrong architecture at /System/ > Library/Perl/5.8.8/darwin-thread-multi-2level/DynaLoader.pm line > 230, line 1. > at /Library/Perl/5.8.6/Inline.pm line 500 > > > at /System/Library/Perl/5.8.8/darwin-thread-multi-2level/ > DynaLoader.pm line 0 > INIT failed--call queue aborted, line 1. > # Looks like you planned 8 tests but only ran 1. > # Looks like your test died just after 1. > t/SeqIO/alf.................................... Dubious, test > returned 255 (wstat 65280, 0xff00) > Failed 7/8 subtests > t/SeqIO/asciitree..............................ok > t/SeqIO/bsml...................................ok > t/SeqIO/bsml_sax...............................skipped: The optional > module XML::SAX::Writer (or dependencies thereof) was not installed > t/SeqIO/chadoxml...............................ok > t/SeqIO/chaos..................................ok > t/SeqIO/chaosxml...............................ok > t/SeqIO/ctf....................................1/4 Had problems > bootstrapping Inline module 'Bio::SeqIO::staden::read' > > Can't load '/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/ > SeqIO/staden/read/read.bundle' for module Bio::SeqIO::staden::read: > dlopen(/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/ > staden/read/read.bundle, 1): no suitable image found. Did find: > /Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/ > staden/read/read.bundle: mach-o, but wrong architecture at /System/ > Library/Perl/5.8.8/darwin-thread-multi-2level/DynaLoader.pm line > 230, line 1. > at /Library/Perl/5.8.6/Inline.pm line 500 > > > at /System/Library/Perl/5.8.8/darwin-thread-multi-2level/ > DynaLoader.pm line 0 > INIT failed--call queue aborted, line 1. > # Looks like you planned 4 tests but only ran 1. > # Looks like your test died just after 1. > t/SeqIO/ctf.................................... Dubious, test > returned 255 (wstat 65280, 0xff00) > Failed 3/4 subtests > t/SeqIO/embl...................................ok > t/SeqIO/entrezgene.............................skipped: The optional > module Bio::ASN1::EntrezGene (or dependencies thereof) was not > installed > t/SeqIO/excel..................................ok > t/SeqIO/exp....................................1/3 Had problems > bootstrapping Inline module 'Bio::SeqIO::staden::read' > > Can't load '/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/ > SeqIO/staden/read/read.bundle' for module Bio::SeqIO::staden::read: > dlopen(/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/ > staden/read/read.bundle, 1): no suitable image found. Did find: > /Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/ > staden/read/read.bundle: mach-o, but wrong architecture at /System/ > Library/Perl/5.8.8/darwin-thread-multi-2level/DynaLoader.pm line > 230, line 1. > at /Library/Perl/5.8.6/Inline.pm line 500 > > > at /System/Library/Perl/5.8.8/darwin-thread-multi-2level/ > DynaLoader.pm line 0 > INIT failed--call queue aborted, line 1. > # Looks like you planned 3 tests but only ran 1. > # Looks like your test died just after 1. > t/SeqIO/exp.................................... Dubious, test > returned 255 (wstat 65280, 0xff00) > Failed 2/3 subtests > t/SeqIO/fasta..................................ok > t/SeqIO/fastq..................................ok > t/SeqIO/flybase_chadoxml.......................ok > t/SeqIO/game...................................ok > t/SeqIO/gcg....................................1/17 > # Failed (TODO) test 'primary_id' > # in t/SeqIO/gcg.t at line 54. > # got: 'Bio::PrimarySeq=HASH(0x97fe30)' > # expected: 'roa1_drome' > t/SeqIO/gcg....................................ok > t/SeqIO/genbank................................ok > t/SeqIO/interpro...............................ok > t/SeqIO/kegg...................................ok > t/SeqIO/largefasta.............................ok > t/SeqIO/lasergene..............................ok > t/SeqIO/locuslink..............................ok > t/SeqIO/metafasta..............................ok > t/SeqIO/phd....................................ok > t/SeqIO/pir....................................ok > t/SeqIO/pln....................................1/4 Had problems > bootstrapping Inline module 'Bio::SeqIO::staden::read' > > Can't load '/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/ > SeqIO/staden/read/read.bundle' for module Bio::SeqIO::staden::read: > dlopen(/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/ > staden/read/read.bundle, 1): no suitable image found. Did find: > /Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/ > staden/read/read.bundle: mach-o, but wrong architecture at /System/ > Library/Perl/5.8.8/darwin-thread-multi-2level/DynaLoader.pm line > 230, line 1. > at /Library/Perl/5.8.6/Inline.pm line 500 > > > at /System/Library/Perl/5.8.8/darwin-thread-multi-2level/ > DynaLoader.pm line 0 > INIT failed--call queue aborted, line 1. > # Looks like you planned 4 tests but only ran 1. > # Looks like your test died just after 1. > t/SeqIO/pln.................................... Dubious, test > returned 255 (wstat 65280, 0xff00) > Failed 3/4 subtests > t/SeqIO/qual...................................ok > t/SeqIO/raw....................................ok > t/SeqIO/scf....................................1/59 > # Failed (TODO) test 'accuracies' > # in t/SeqIO/scf.t at line 78. > # got: 'ARRAY(0x995314)' > # expected: '482' > t/SeqIO/scf....................................ok > t/SeqIO/strider................................skipped: The optional > module Convert::Binary::C (or dependencies thereof) was not installed > t/SeqIO/swiss..................................ok > t/SeqIO/tab....................................ok > t/SeqIO/table..................................ok > t/SeqIO/tigr...................................ok > t/SeqIO/tigrxml................................skipped: The optional > module XML::SAX::Writer (or dependencies thereof) was not installed > t/SeqIO/tinyseq................................ok > t/SeqIO/ztr....................................1/3 Had problems > bootstrapping Inline module 'Bio::SeqIO::staden::read' > > Can't load '/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/ > SeqIO/staden/read/read.bundle' for module Bio::SeqIO::staden::read: > dlopen(/Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/ > staden/read/read.bundle, 1): no suitable image found. Did find: > /Library/Perl/5.8.6/darwin-thread-multi-2level/auto/Bio/SeqIO/ > staden/read/read.bundle: mach-o, but wrong architecture at /System/ > Library/Perl/5.8.8/darwin-thread-multi-2level/DynaLoader.pm line > 230, line 1. > at /Library/Perl/5.8.6/Inline.pm line 500 > > > at /System/Library/Perl/5.8.8/darwin-thread-multi-2level/ > DynaLoader.pm line 0 > INIT failed--call queue aborted, line 1. > # Looks like you planned 3 tests but only ran 1. > # Looks like your test died just after 1. > t/SeqIO/ztr.................................... Dubious, test > returned 255 (wstat 65280, 0xff00) > Failed 2/3 subtests > t/SeqTools/CodonTable..........................ok > t/SeqTools/ECnumber............................ok > t/SeqTools/GuessSeqFormat......................ok > t/SeqTools/OddCodes............................ok > t/SeqTools/SeqPattern..........................ok > t/SeqTools/SeqStats............................ok > t/SeqTools/SeqUtils............................ok > t/SeqTools/SeqWords............................ok > t/Species......................................ok > t/Structure/IO.................................ok > t/Structure/Structure..........................ok > t/Symbol.......................................ok > t/TaxonTree....................................skipped: All tests > are being skipped, probably because the module(s) being tested here > are now deprecated > t/Tools/Alignment/Consed.......................ok > t/Tools/Analysis/DNA/ESEfinder.................skipped: Network > tests have not been requested > t/Tools/Analysis/Protein/Domcut................skipped: Network > tests have not been requested > t/Tools/Analysis/Protein/ELM...................skipped: Network > tests have not been requested > t/Tools/Analysis/Protein/GOR4..................skipped: Network > tests have not been requested > t/Tools/Analysis/Protein/HNN...................skipped: Network > tests have not been requested > t/Tools/Analysis/Protein/Mitoprot..............skipped: Network > tests have not been requested > t/Tools/Analysis/Protein/NetPhos...............skipped: Network > tests have not been requested > t/Tools/Analysis/Protein/Scansite..............ok > t/Tools/Analysis/Protein/Sopma.................ok > t/Tools/EMBOSS/Palindrome......................ok > t/Tools/EUtilities/EUtilParameters.............ok > t/Tools/EUtilities/egquery.....................ok > t/Tools/EUtilities/einfo.......................ok > t/Tools/EUtilities/elink_acheck................ok > t/Tools/EUtilities/elink_lcheck................ok > t/Tools/EUtilities/elink_llinks................ok > t/Tools/EUtilities/elink_ncheck................ok > t/Tools/EUtilities/elink_neighbor..............ok > t/Tools/EUtilities/elink_neighbor_history......ok > t/Tools/EUtilities/elink_scores................ok > t/Tools/EUtilities/epost.......................ok > t/Tools/EUtilities/esearch.....................ok > t/Tools/EUtilities/espell......................ok > t/Tools/EUtilities/esummary....................ok > t/Tools/Est2Genome.............................ok > t/Tools/FootPrinter............................ok > t/Tools/GFF....................................ok > t/Tools/Geneid.................................ok > t/Tools/Genewise...............................ok > t/Tools/Genomewise.............................ok > t/Tools/Genpred................................ok > t/Tools/Hmmer..................................ok > t/Tools/IUPAC..................................ok > t/Tools/Lucy...................................ok > t/Tools/Match..................................ok > t/Tools/Phylo/Gerp.............................ok > t/Tools/Phylo/Molphy...........................ok > t/Tools/Phylo/PAML.............................ok > t/Tools/Phylo/Phylip/ProtDist..................ok > t/Tools/Primer3................................ok > t/Tools/Promoterwise...........................ok > t/Tools/Pseudowise.............................ok > t/Tools/QRNA...................................ok > t/Tools/RandDistFunctions......................ok > t/Tools/RepeatMasker...........................ok > t/Tools/Run/RemoteBlast........................skipped: Network > tests have not been requested > t/Tools/Run/StandAloneBlast....................ok > t/Tools/Run/WrapperBase........................ok > t/Tools/Seg....................................ok > t/Tools/SiRNA..................................ok > t/Tools/Sigcleave..............................ok > t/Tools/Signalp................................ok > t/Tools/Signalp/ExtendedSignalp................ok > t/Tools/Sim4...................................ok > t/Tools/Spidey/Spidey..........................ok > t/Tools/TandemRepeatsFinder....................ok > t/Tools/TargetP................................ok > t/Tools/Tmhmm..................................ok > t/Tools/ePCR...................................ok > t/Tools/pICalculator...........................ok > t/Tools/rnamotif...............................skipped: All tests > are being skipped, probably because the module(s) being tested here > are now deprecated > t/Tools/tRNAscanSE.............................ok > t/Tree/Compatible..............................ok > t/Tree/Node....................................ok > t/Tree/PhyloNetwork/Factory....................ok > t/Tree/PhyloNetwork/GraphViz...................ok > t/Tree/PhyloNetwork/MuVector...................ok > t/Tree/PhyloNetwork/PhyloNetwork...............ok > t/Tree/PhyloNetwork/RandomFactory..............skipped: The optional > module Math::Random (or dependencies thereof) was not installed > t/Tree/PhyloNetwork/TreeFactory................ok > t/Tree/RandomTreeFactory.......................ok > t/Tree/Tree....................................ok > t/Tree/TreeIO..................................ok > t/Tree/TreeIO/lintree..........................ok > t/Tree/TreeIO/newick...........................ok > t/Tree/TreeIO/nexus............................ok > t/Tree/TreeIO/nhx..............................ok > t/Tree/TreeIO/phyloxml.........................You tried to plan > twice! Second plan at t/Tree/TreeIO/phyloxml.t line 17 > BEGIN failed--compilation aborted at t/Tree/TreeIO/phyloxml.t line 22. > # Looks like your test died before it could output anything. > t/Tree/TreeIO/phyloxml......................... Dubious, test > returned 255 (wstat 65280, 0xff00) > Failed 97/97 subtests > t/Tree/TreeIO/svggraph.........................1/4 Use of > uninitialized value in join or string at /Library/Perl/5.8.6/SVG/ > Element.pm line 1169, line 1. > t/Tree/TreeIO/svggraph.........................ok > t/Tree/TreeIO/tabtree..........................ok > t/Tree/TreeStatistics..........................ok > t/Variation/AAChange...........................ok > t/Variation/AAReverseMutate....................ok > t/Variation/Allele.............................ok > t/Variation/DNAMutation........................ok > t/Variation/RNAChange..........................ok > t/Variation/SNP................................ok > t/Variation/SeqDiff............................ok > t/Variation/Variation_IO.......................ok > > > On Jan 16, 2009, at 2:11 PM, Chris Fields wrote: > >> All, >> >> I would like to announce that the third (and hopefully final) >> release candidate for BioPerl 1.6 is now available for testing. As >> this is likely the final release candidate, any errors encountered >> during regression tests would be greatly appreciated. >> >> A quick note on versioning: due to issues with alpha numbered >> versions on CPAN possibly overwriting or taking precedence over a >> stable release, this release candidate has a VERSION of >> 1.005009_003 (or 1.005009003). This will be switched to 1.006000 >> (no alpha) once the release is final. >> >> The RC is currently being uploaded to CPAN and should be available >> in the next 24-48 hours under authorname CJFIELDS. In the >> meantime, the release candidates can be directly downloaded here: >> >> http://bioperl.org/DIST/BioPerl-1.5.9_3.tar.bz2 >> http://bioperl.org/DIST/BioPerl-1.5.9_3.tar.gz >> http://bioperl.org/DIST/BioPerl-1.5.9_3.zip >> >> Signature file: >> http://bioperl.org/DIST/SIGNATURES.md5 >> >> A preliminary ActiveState PPM is also available and is located in >> the BioPerl Release Candidate repository; the directions for >> installation are here: >> >> http://www.bioperl.org/wiki/Installing_Bioperl_on_Windows >> >> Please feel free to report issues with testing, installation, etc. >> on the mail list and on this page: >> >> http://www.bioperl.org/wiki/Release_1.6_Testing >> >> Again, just to note we will be releasing bioperl-run, bioperl-db, >> bioperl-network, and others separately once the final 1.6 release >> is complete. >> >> Since the last release: >> >> Fixes: >> >> 1) Remote database tests are now a bit more robust. >> 2) Bio::DB::GDB and related tests have been deprecated and removed >> (GDB is no longer available). >> 3) More warnings and test failures (via CPAN Testers) now fixed. >> 4) BLAST-related file and parsing issues resolved (per Scott Markel). >> 5) Small test fixes. >> >> Known Issues: >> >> 1) Warnings for Bio::Assembly tests are for incomplete phrap >> parsing. These modules will be a focus of BioPerl 1.7; in the >> meantime I'll see about quenching the tests. >> 2) Warnings for Bio::Annotation tests can be fixed by an upgrade to >> the latest Data::Stag (this is NOT a required upgrade). >> 3) PPM issues; note this is not high on our priority list ATM but I >> will try to address it for the next release. >> 4) Small warning for t/Tree/TreeIO/svggraph.t due to an issue with >> SVG::Graph. >> >> Enjoy! >> >> chris >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From cjfields at illinois.edu Sun Jan 18 00:22:58 2009 From: cjfields at illinois.edu (Chris Fields) Date: Sat, 17 Jan 2009 23:22:58 -0600 Subject: [Bioperl-l] evalues/floating point tests In-Reply-To: <1C24073D1D9A47129D96783531D718F9@NewLife> References: <79B1C536-4723-45B0-8AE6-209BDE84F5CF@illinois.edu><49726D91.8050003@sendu.me.uk> <7A9332DC-3BFD-4CBD-AE86-0E67ED024976@illinois.edu> <1C24073D1D9A47129D96783531D718F9@NewLife> Message-ID: <3473B833-728C-4548-96E4-E2716F94ED1C@illinois.edu> is_float_eq()? On Jan 17, 2009, at 8:44 PM, Mark A. Jensen wrote: > how bout is_asfloat() ? > ----- Original Message ----- From: "Chris Fields" > > To: "Sendu Bala" > Cc: "BioPerl List" > Sent: Saturday, January 17, 2009 9:24 PM > Subject: Re: [Bioperl-l] evalues/floating point tests > > >> On Jan 17, 2009, at 5:45 PM, Sendu Bala wrote: >>> Chris Fields wrote: >>>> I've noticed an odd issue when testing BioPerl on WinXP >>>> yesterday which doesn't appear to be popping up anywhere else. >>>> When comparing floating point numbers, several tests fail like >>>> the following: >>>> # Failed test at t\SearchIO\blast_pull.t line 40. >>>> # got: '1e-23' >>>> # expected: '1e-023' >>>> # Failed test at t\SearchIO\blast_pull.t line 67. >>>> # got: '6e-59' >>>> # expected: '6e-059' >>>> These are generally in lines like (for the example above) >>>> is $result->get_parameter('expect'), 1e-23; >>>> I'm adding a method to Bio::Root::Test for comparing two >>>> floating point numbers based on equality: >>>> float_eq $float1, $float2, $message; >>>> This basically wraps is() but runs both values through >>>> 'sprintf("%g", $foo)' prior to the comparison; it has a >>>> prototype requiring two values to be passed and an optional >>>> message. Any objections to the method name or adding this in? >>> >>> is_float() seems more consistent? Other than that, great idea. >> I thought the same thing at first, but (at least to me) is_float >> sounds more like a boolean test on whether the scalar value passed >> is a float rather than a comparison checking whether two floats >> are equal. >> I'll go ahead and commit this, but it would be very easy to switch >> the method name over. >> chris >> _______________________________________________ >> Bioperl-l mailing list >> Bioperl-l at lists.open-bio.org >> http://lists.open-bio.org/mailman/listinfo/bioperl-l >> > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From hlapp at gmx.net Sun Jan 18 14:28:15 2009 From: hlapp at gmx.net (Hilmar Lapp) Date: Sun, 18 Jan 2009 14:28:15 -0500 Subject: [Bioperl-l] evalues/floating point tests In-Reply-To: <3473B833-728C-4548-96E4-E2716F94ED1C@illinois.edu> References: <79B1C536-4723-45B0-8AE6-209BDE84F5CF@illinois.edu><49726D91.8050003@sendu.me.uk> <7A9332DC-3BFD-4CBD-AE86-0E67ED024976@illinois.edu> <1C24073D1D9A47129D96783531D718F9@NewLife> <3473B833-728C-4548-96E4-E2716F94ED1C@illinois.edu> Message-ID: <4E8C7FA9-61F9-4B5E-9890-F49D145EBF27@gmx.net> On Jan 18, 2009, at 12:22 AM, Chris Fields wrote: > is_float_eq()? That's the best so far, to me anyway. -hilmar -- =========================================================== : Hilmar Lapp -:- Durham, NC -:- hlapp at gmx dot net : =========================================================== From cjfields at illinois.edu Sun Jan 18 15:00:53 2009 From: cjfields at illinois.edu (Chris Fields) Date: Sun, 18 Jan 2009 14:00:53 -0600 Subject: [Bioperl-l] evalues/floating point tests In-Reply-To: <4E8C7FA9-61F9-4B5E-9890-F49D145EBF27@gmx.net> References: <79B1C536-4723-45B0-8AE6-209BDE84F5CF@illinois.edu><49726D91.8050003@sendu.me.uk> <7A9332DC-3BFD-4CBD-AE86-0E67ED024976@illinois.edu> <1C24073D1D9A47129D96783531D718F9@NewLife> <3473B833-728C-4548-96E4-E2716F94ED1C@illinois.edu> <4E8C7FA9-61F9-4B5E-9890-F49D145EBF27@gmx.net> Message-ID: <95D235CF-A2F4-46CA-BDFC-2822D416853F@illinois.edu> Works for me. Done (in r15402). chris On Jan 18, 2009, at 1:28 PM, Hilmar Lapp wrote: > > On Jan 18, 2009, at 12:22 AM, Chris Fields wrote: > >> is_float_eq()? > > > That's the best so far, to me anyway. -hilmar > > -- > =========================================================== > : Hilmar Lapp -:- Durham, NC -:- hlapp at gmx dot net : > =========================================================== > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l From maj at fortinbras.us Sun Jan 18 14:56:44 2009 From: maj at fortinbras.us (Mark A. Jensen) Date: Sun, 18 Jan 2009 14:56:44 -0500 Subject: [Bioperl-l] evalues/floating point tests In-Reply-To: <4E8C7FA9-61F9-4B5E-9890-F49D145EBF27@gmx.net> References: <79B1C536-4723-45B0-8AE6-209BDE84F5CF@illinois.edu><49726D91.8050003@sendu.me.uk><7A9332DC-3BFD-4CBD-AE86-0E67ED024976@illinois.edu><1C24073D1D9A47129D96783531D718F9@NewLife><3473B833-728C-4548-96E4-E2716F94ED1C@illinois.edu> <4E8C7FA9-61F9-4B5E-9890-F49D145EBF27@gmx.net> Message-ID: <0781906CD9284791B6ADEF6B07EF623E@NewLife> I like it- ----- Original Message ----- From: "Hilmar Lapp" To: "Chris Fields" Cc: "BioPerl List" ; "Mark A. Jensen" Sent: Sunday, January 18, 2009 2:28 PM Subject: Re: [Bioperl-l] evalues/floating point tests > > On Jan 18, 2009, at 12:22 AM, Chris Fields wrote: > >> is_float_eq()? > > > That's the best so far, to me anyway. -hilmar > > -- > =========================================================== > : Hilmar Lapp -:- Durham, NC -:- hlapp at gmx dot net : > =========================================================== > > > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > From bix at sendu.me.uk Sun Jan 18 07:01:48 2009 From: bix at sendu.me.uk (Sendu Bala) Date: Sun, 18 Jan 2009 12:01:48 +0000 Subject: [Bioperl-l] evalues/floating point tests In-Reply-To: <3473B833-728C-4548-96E4-E2716F94ED1C@illinois.edu> References: <79B1C536-4723-45B0-8AE6-209BDE84F5CF@illinois.edu><49726D91.8050003@sendu.me.uk> <7A9332DC-3BFD-4CBD-AE86-0E67ED024976@illinois.edu> <1C24073D1D9A47129D96783531D718F9@NewLife> <3473B833-728C-4548-96E4-E2716F94ED1C@illinois.edu> Message-ID: <49731A2C.1000803@sendu.me.uk> Chris Fields wrote: > is_float_eq()? The 'is' obviates the need for the 'eq'. On the other hand there's precedent for this, since is() actually calls is_eq(). > On Jan 17, 2009, at 8:44 PM, Mark A. Jensen wrote: > >> how bout is_asfloat() ? This is better. However... > I thought the same thing at first, but (at least to me) is_float > sounds more like a boolean test on whether the scalar value passed is > a float rather than a comparison checking whether two floats are > equal. I understand that, but the naming convention is already like that. is_deeply() doesn't test if both values are 'deep', it tests if they are 'is' (are equal) in a deep way. is_float() would test if they are 'is' (are equal) in a float way. Yeah, grammatically it is all a mess, but to me this seems the most consistent. The alternative, which may at the same time may be safer (the test writer doesn't need to remember to use a special function) and more dangerous (the regex matches something it shouldn't?), is to simply override is(): my $e_num = '^\de-\d+$'; sub is { my ($val1, $val2, @args) = @_; if ($val1 && $val2 && $val1 =~ /$e_num/ && $val2 =~ /$e_num/) { $val1 = sprintf("%g", $val1); $val2 = sprintf("%g", $val2); } return SUPER::is($val1, $val2, @args); } Or something like that. I didn't try it. From cjfields at illinois.edu Sun Jan 18 17:51:42 2009 From: cjfields at illinois.edu (Chris Fields) Date: Sun, 18 Jan 2009 16:51:42 -0600 Subject: [Bioperl-l] evalues/floating point tests In-Reply-To: <49731A2C.1000803@sendu.me.uk> References: <79B1C536-4723-45B0-8AE6-209BDE84F5CF@illinois.edu><49726D91.8050003@sendu.me.uk> <7A9332DC-3BFD-4CBD-AE86-0E67ED024976@illinois.edu> <1C24073D1D9A47129D96783531D718F9@NewLife> <3473B833-728C-4548-96E4-E2716F94ED1C@illinois.edu> <49731A2C.1000803@sendu.me.uk> Message-ID: On Jan 18, 2009, at 6:01 AM, Sendu Bala wrote: > Chris Fields wrote: >> is_float_eq()? > > The 'is' obviates the need for the 'eq'. On the other hand there's > precedent for this, since is() actually calls is_eq(). Yes, that's partly why I suggested it. That's most descriptive of what we are doing with this method, 'is float $ev1 eq float $ev2'. >> On Jan 17, 2009, at 8:44 PM, Mark A. Jensen wrote: >>> how bout is_asfloat() ? > > This is better. However... Sorry, no disrespect to you or Mark but I don't agree. 'Is as float' doesn't come across to me as an equality test, it almost sounds like a role/interface check. >> I thought the same thing at first, but (at least to me) is_float >> sounds more like a boolean test on whether the scalar value passed is >> a float rather than a comparison checking whether two floats are >> equal. > > I understand that, but the naming convention is already like that. > is_deeply() doesn't test if both values are 'deep', it tests if they > are 'is' (are equal) in a deep way. is_float() would test if they > are 'is' (are equal) in a float way. Yeah, grammatically it is all a > mess, but to me this seems the most consistent. I see what you're saying in this case. We can go back to the simpler is_float() if everyone agrees. Just want to have something decided so we can move on. > The alternative, which may at the same time may be safer (the test > writer doesn't need to remember to use a special function) and more > dangerous (the regex matches something it shouldn't?), is to simply > override is(): > > my $e_num = '^\de-\d+$'; > sub is { > my ($val1, $val2, @args) = @_; > > if ($val1 && $val2 && $val1 =~ /$e_num/ && $val2 =~ /$e_num/) { > $val1 = sprintf("%g", $val1); > $val2 = sprintf("%g", $val2); > } > > return SUPER::is($val1, $val2, @args); > } > > Or something like that. I didn't try it. I understand the sentiment about extending is() but I'm not convinced it makes sense for a specific case such as this. I agree with the second sentiment; extending is() may be more dangerous and prone to subtle issues, such as the regex above not matching '1.23e-12'. Yes, I know, you didn't test it. ;> And, if we ever change our minds it would be very easy to just delegate to is_float(). $e_num = qr/something that matches just floats/; sub is { my ($val1, $val2, @args) = @_; if ($val1 && $val2 && $val1 =~ /$e_num/ && $val2 =~ /$e_num/) { return is_float($val1, $val2, @args); } else { return SUPER::is($val1, $val2, @args); } } chris From maj at fortinbras.us Sun Jan 18 19:22:26 2009 From: maj at fortinbras.us (Mark A. Jensen) Date: Sun, 18 Jan 2009 19:22:26 -0500 Subject: [Bioperl-l] evalues/floating point tests In-Reply-To: References: <79B1C536-4723-45B0-8AE6-209BDE84F5CF@illinois.edu><49726D91.8050003@sendu.me.uk><7A9332DC-3BFD-4CBD-AE86-0E67ED024976@illinois.edu><1C24073D1D9A47129D96783531D718F9@NewLife><3473B833-728C-4548-96E4-E2716F94ED1C@illinois.edu><49731A2C.1000803@sendu.me.uk> Message-ID: <58919FE966814564BD76F9F31E76BD99@NewLife> (I promise I won't prolong this any further than...) Maybe is_float suffers from the same sematic issue as is_asfloat raised by Chris. Note that in Sendu's example, deeply is an adverb, so it suggests doing something, and float as a noun/adjective (in truth) suggests being something. So, what about float_is() which suggests that this version of is() is described by float (float_is'ing rather than string_is'ing) (I'm perfectly content with is_float, though) ----- Original Message ----- From: "Chris Fields" To: "Sendu Bala" Cc: "BioPerl List" ; "Mark A. Jensen" Sent: Sunday, January 18, 2009 5:51 PM Subject: Re: [Bioperl-l] evalues/floating point tests > On Jan 18, 2009, at 6:01 AM, Sendu Bala wrote: > >> Chris Fields wrote: >>> is_float_eq()? >> >> The 'is' obviates the need for the 'eq'. On the other hand there's precedent >> for this, since is() actually calls is_eq(). > > Yes, that's partly why I suggested it. That's most descriptive of what we > are doing with this method, 'is float $ev1 eq float $ev2'. > >>> On Jan 17, 2009, at 8:44 PM, Mark A. Jensen wrote: >>>> how bout is_asfloat() ? >> >> This is better. However... > > Sorry, no disrespect to you or Mark but I don't agree. 'Is as float' doesn't > come across to me as an equality test, it almost sounds like a role/interface > check. > >>> I thought the same thing at first, but (at least to me) is_float >>> sounds more like a boolean test on whether the scalar value passed is >>> a float rather than a comparison checking whether two floats are >>> equal. >> >> I understand that, but the naming convention is already like that. >> is_deeply() doesn't test if both values are 'deep', it tests if they are >> 'is' (are equal) in a deep way. is_float() would test if they are 'is' (are >> equal) in a float way. Yeah, grammatically it is all a mess, but to me this >> seems the most consistent. > > I see what you're saying in this case. We can go back to the simpler > is_float() if everyone agrees. Just want to have something decided so we can > move on. > >> The alternative, which may at the same time may be safer (the test writer >> doesn't need to remember to use a special function) and more dangerous (the >> regex matches something it shouldn't?), is to simply override is(): >> >> my $e_num = '^\de-\d+$'; >> sub is { >> my ($val1, $val2, @args) = @_; >> >> if ($val1 && $val2 && $val1 =~ /$e_num/ && $val2 =~ /$e_num/) { >> $val1 = sprintf("%g", $val1); >> $val2 = sprintf("%g", $val2); >> } >> >> return SUPER::is($val1, $val2, @args); >> } >> >> Or something like that. I didn't try it. > > I understand the sentiment about extending is() but I'm not convinced it > makes sense for a specific case such as this. I agree with the second > sentiment; extending is() may be more dangerous and prone to subtle issues, > such as the regex above not matching '1.23e-12'. Yes, I know, you didn't test > it. ;> > > And, if we ever change our minds it would be very easy to just delegate to > is_float(). > > $e_num = qr/something that matches just floats/; > sub is { > my ($val1, $val2, @args) = @_; > > if ($val1 && $val2 && $val1 =~ /$e_num/ && $val2 =~ /$e_num/) { > return is_float($val1, $val2, @args); > } else { > return SUPER::is($val1, $val2, @args); > } > } > > chris > > _______________________________________________ > Bioperl-l mailing list > Bioperl-l at lists.open-bio.org > http://lists.open-bio.org/mailman/listinfo/bioperl-l > > From chad.davis at embl.de Mon Jan 19 02:33:45 2009 From: chad.davis at embl.de (Chad Davis) Date: Mon, 19 Jan 2009 08:33:45 +0100 Subject: [Bioperl-l] evalues/floating point tests In-Reply-To: <58919FE966814564BD76F9F31E76BD99@NewLife> References: <79B1C536-4723-45B0-8AE6-209BDE84F5CF@illinois.edu> <49726D91.8050003@sendu.me.uk> <7A9332DC-3BFD-4CBD-AE86-0E67ED024976@illinois.edu> <1C24073D1D9A47129D96783531D718F9@NewLife> <3473B833-728C-4548-96E4-E2716F94ED1C@illinois.edu> <49731A2C.1000803@sendu.me.uk> <58919FE966814564BD76F9F31E76BD99@NewLife> Message-ID: I would like to suggest, once the naming issue has been resolved, that this also be sent on to the Test::More people. Seems it would be generally useful, beyond Bioperl, to validate floating point numbers in tests. I'm doing this by hand in my current tests with something like: $tolerance = 0.001; ok($got < $expected + $tolerance && $got > $expected - $tolerance, "Within tolerated rounding error ..."); ... which is a very indirect workaround. And if anyone is counting, I also vote for Mark's "float_is" ("float" being the adjective modifying the type of "is", rather than a predicate, which can become confusing, as you noted). Thanks for all the work on 1.6, Cheers, Chad On Mon, Jan 19, 2009 at 01:22, Mark A. Jensen wrote: > (I promise I won't prolong this any further than...) > > Maybe is_float suffers from the same sematic issue as is_asfloat raised by > Chris. Note that in Sendu's example, deeply is an adverb, so it suggests > doing something, and float as a noun/adjective (in truth) suggests being > something. So, what about > float_is() > which suggests that this version of is() is described by float > (float_is'ing rather than string_is'ing) > > (I'm perfectly content with is_float, though) > > ----- Original Message ----- From: "Chris Fields" > To: "Sendu Bala" > Cc: "BioPerl List" ; "Mark A. Jensen" < > maj at fortinbras.us> > Sent: Sunday, January 18, 2009 5:51 PM > Subject: Re: [Bioperl-l] evalues/floating point tests > > > On Jan 18, 2009, at 6:01 AM, Sendu Bala wrote: >> >> Chris Fields wrote: >>> >>>> is_float_eq()? >>>> >>> >>> The 'is' obviates the need for the 'eq'. On the other hand there's >>> precedent for this, since is() actually calls is_eq(). >>> >> >> Yes, that's partly why I suggested it. That's most descriptive of what >> we are doing with this method, 'is float $ev1 eq float $ev2'. >> >> On Jan 17, 2009, at 8:44 PM, Mark A. Jensen wrote: >>>> >>>>> how bout is_asfloat() ? >>>>> >>>> >>> This is better. However... >>> >> >> Sorry, no disrespect to you or Mark but I don't agree. 'Is as float' >> doesn't come across to me as an equality test, it almost sounds like a >> role/interface check. >> >> I thought the same thing at first, but (at least to me) is_float >>>> sounds more like a boolean test on whether the scalar value passed is >>>> a float rather than a comparison checking whether two floats are >>>> equal. >>>> >>> >>> I understand that, but the naming convention is already like that. >>> is_deeply() doesn't test if both values are 'deep', it tests if they are >>> 'is' (are equal) in a deep way. is_float() would test if they are 'is' (are >>> equal)